ID: 911046510

View in Genome Browser
Species Human (GRCh38)
Location 1:93633284-93633306
Sequence AGATTCTAACAGGATGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911046510_911046512 -2 Left 911046510 1:93633284-93633306 CCATTTACATCCTGTTAGAATCT 0: 1
1: 0
2: 1
3: 13
4: 209
Right 911046512 1:93633305-93633327 CTCTCAGCTTCCCTAATAACTGG 0: 1
1: 0
2: 12
3: 374
4: 5745
911046510_911046513 -1 Left 911046510 1:93633284-93633306 CCATTTACATCCTGTTAGAATCT 0: 1
1: 0
2: 1
3: 13
4: 209
Right 911046513 1:93633306-93633328 TCTCAGCTTCCCTAATAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911046510 Original CRISPR AGATTCTAACAGGATGTAAA TGG (reversed) Intronic
903978840 1:27170637-27170659 GGATTCTAACAGGAAACAAATGG + Intergenic
904304254 1:29577343-29577365 AGAATCTAACAGTGTGAAAAGGG + Intergenic
905071607 1:35230668-35230690 GGATTTTAACAGAATGAAAAGGG + Intergenic
907292056 1:53421801-53421823 AAATTGTAAGAGGTTGTAAAAGG + Intergenic
908444538 1:64188685-64188707 AGATACACACAGTATGTAAACGG - Intergenic
909704109 1:78561174-78561196 ATATCCTAAAAGAATGTAAAAGG - Intergenic
910683373 1:89890532-89890554 AGATTCTGCCAGGAGATAAAGGG - Intronic
911046510 1:93633284-93633306 AGATTCTAACAGGATGTAAATGG - Intronic
911411121 1:97508792-97508814 AGGTTGTAACAGCATGGAAATGG - Intronic
911466645 1:98262856-98262878 ACGTCCTAACAGGGTGTAAAAGG - Intergenic
912636071 1:111294907-111294929 TGAATTTAACAGGATGTTAAGGG - Intronic
912866910 1:113266008-113266030 AGATTCTAACAAGAAGGATAGGG + Intergenic
913047033 1:115083033-115083055 AAATTCAAAGAGGATGAAAAAGG + Intronic
913201702 1:116499819-116499841 AGACTCTAAAAGCATGTGAAAGG - Intergenic
917056370 1:170986420-170986442 AGACTCCAACAAGATGTATATGG + Intronic
919700531 1:200626942-200626964 GCATTCTAACTGGATGAAAAGGG + Intronic
922783182 1:228269484-228269506 ACATTCTAACAGAATGCAAAAGG - Intronic
923218588 1:231872929-231872951 AGATTATTTCAGAATGTAAAAGG - Intronic
1066195925 10:33099887-33099909 AGATTCTCACAGGGTGTCAGGGG - Intergenic
1066269348 10:33807202-33807224 AGCTTCTAACAGGCATTAAATGG - Intergenic
1067786487 10:49253378-49253400 AGATTTTAACTGGATGAAAGAGG - Intergenic
1067813664 10:49453229-49453251 AGATTCTGATAAGATGTATATGG - Intergenic
1068778710 10:60896418-60896440 AGAATCAAATAGGATTTAAATGG + Intronic
1075497754 10:122941660-122941682 TGATTCTTACAGGATGTACCTGG - Intronic
1077270237 11:1674279-1674301 AGATTCTATAAATATGTAAAAGG - Intergenic
1082844359 11:57715558-57715580 AAATTCTAAGAGGTTATAAAAGG - Intronic
1084362314 11:68677017-68677039 AGATTCTAAGAGGCTGTAAACGG + Intergenic
1086861797 11:91933133-91933155 GGATTCTAACAGGAAATAAGTGG - Intergenic
1089263176 11:117236955-117236977 AGAGTCAAACAGCTTGTAAATGG + Intronic
1090236311 11:125150572-125150594 AGTTTCTTTCAGAATGTAAAAGG + Intergenic
1092566183 12:9668069-9668091 AAATTATAAAAGGATATAAAAGG + Intronic
1093594217 12:20942143-20942165 AGATTATAAAAGGTTATAAAAGG - Intergenic
1095905041 12:47369010-47369032 AGATTGTAACAGGAGGGAGAAGG + Intergenic
1096631566 12:52930175-52930197 GGCTTCTAATTGGATGTAAAGGG - Intronic
1096668704 12:53184791-53184813 AGTTTGTAGCAGGGTGTAAAAGG + Intronic
1097315920 12:58171472-58171494 AGATGCAATCAGGATGGAAACGG + Intergenic
1098339089 12:69432965-69432987 ATATTCTAACAAGATGTTAAAGG - Intergenic
1098355996 12:69613122-69613144 AGAGTACAAAAGGATGTAAATGG - Intergenic
1099904442 12:88755711-88755733 ACATTCTGATAGGAAGTAAAAGG + Intergenic
1101084320 12:101220192-101220214 AGATTCTAACAGGAGGAGATAGG - Intergenic
1106987114 13:35367522-35367544 AGCTTCTAACAGTATGCACAAGG - Intronic
1109700707 13:66021024-66021046 AGAATTCATCAGGATGTAAATGG - Intergenic
1110673848 13:78214888-78214910 GGATTTTAACAGGATTTAAAGGG + Intergenic
1110967363 13:81716339-81716361 TGATTGCAACAGGATGAAAAAGG + Intergenic
1110988766 13:82010146-82010168 AGATTCTGACAAAATGTATATGG - Intergenic
1113735568 13:112676673-112676695 AGATTGCAGCAGGATGTCAAAGG + Intronic
1115439486 14:33415806-33415828 AGTATCTAATAGGATGTAAAGGG - Intronic
1118653425 14:67922375-67922397 ATAATCTAACAAGATGTTAAGGG - Intronic
1120154051 14:81071842-81071864 AAATTCAAACAAAATGTAAATGG - Intronic
1120964707 14:90157317-90157339 TGACTCTAACGGGATGAAAAGGG - Intronic
1125330752 15:38579905-38579927 GGGTTCTAACAGGATGTTTAGGG + Intergenic
1125411667 15:39412640-39412662 TGATTATAACTGGATGTAAAGGG - Intergenic
1126324492 15:47462039-47462061 TCACGCTAACAGGATGTAAAAGG - Intronic
1126501518 15:49351312-49351334 AGACTTTAACATGATCTAAAAGG - Intronic
1126727315 15:51644989-51645011 AGATTCAAACCAGATCTAAATGG + Intergenic
1127191882 15:56539857-56539879 TGATTCTAAGAGGATTAAAATGG - Intergenic
1130751170 15:86714771-86714793 CCATTCTACCACGATGTAAAGGG + Intronic
1131499883 15:92952192-92952214 AGATTTCAACAGGATATTAATGG - Intronic
1133620940 16:7525789-7525811 GGATTCTAACAGCATTCAAAAGG - Intronic
1138906801 16:61346203-61346225 AGATTGTAACAACAAGTAAATGG - Intergenic
1139264270 16:65624390-65624412 AGATTCTAACAGGTTTTGTAGGG + Intergenic
1141292560 16:82733727-82733749 AAACTCTACCAGGATATAAATGG + Intronic
1143356068 17:6329669-6329691 AGATTCTAACAGCATCACAAAGG + Intergenic
1143826142 17:9609270-9609292 ACATTCTAGCAGGAAGGAAAAGG + Intronic
1145914920 17:28567092-28567114 AGATGCTAAAAATATGTAAAAGG + Intronic
1147394696 17:40132833-40132855 AGATTCTAAAAGGATGTGGATGG + Intronic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1148561159 17:48607267-48607289 AGATACACACAGAATGTAAAAGG + Exonic
1149754524 17:59176019-59176041 ACATTATAATAGGATGTAACTGG + Intronic
1149890354 17:60384066-60384088 AGATTCTAACTGGAGATAAGGGG + Intronic
1154100936 18:11472928-11472950 AGATTCTAAGAGTATGTCCATGG + Intergenic
1154208364 18:12357095-12357117 TTAGTCTAACAGTATGTAAAGGG + Intronic
1154345138 18:13536996-13537018 AGAATCTAACAATATATAAAAGG - Intronic
1154958713 18:21286370-21286392 AGATTCTAACAGGAAGGAGGAGG + Intronic
1155364993 18:25040962-25040984 AGATTCTCACAGCCTGCAAAGGG - Intergenic
1155527579 18:26732694-26732716 AAAATCTAACTGGAGGTAAAAGG + Intergenic
1156205748 18:34883740-34883762 AGATTGTAGCAGGAGGGAAACGG + Intronic
1158019133 18:52820580-52820602 AGAATTGAACAGGATGAAAAGGG + Intronic
1158553293 18:58455284-58455306 AGTTTCTAAAAGGAAGAAAAGGG + Intergenic
1158734143 18:60060880-60060902 AGATTCCAAGAGGAGGTAAGTGG + Intergenic
1159508459 18:69365107-69365129 AGATCAAAACAGGATGTAATGGG + Intergenic
1164202389 19:23029628-23029650 AGGTTTTAACAGGATGGTAAGGG + Intergenic
1164821768 19:31256278-31256300 GGATTCTAATGAGATGTAAAGGG - Intergenic
1165678476 19:37750003-37750025 ACATTCTAAGAGGGGGTAAAAGG + Intronic
1168549532 19:57281279-57281301 AGATGCCAAAAGGATGTGAAAGG - Intronic
925321833 2:2976326-2976348 AGATGCTCACAGGAGGTGAACGG + Intergenic
927065694 2:19468728-19468750 AGATTATAATAGAAGGTAAATGG - Intergenic
928058397 2:28083062-28083084 AGACTCTAACAGGCTGAAGAAGG - Intronic
929113699 2:38426532-38426554 AAATTCTGCCAGGATGTAGATGG + Intergenic
931170656 2:59800222-59800244 AGATTATAATAGAATCTAAAGGG + Intergenic
933380292 2:81534322-81534344 AAATTCTAACAGGATAGGAAGGG + Intergenic
938925216 2:136033478-136033500 TGATTCTAACATTATGTCAAAGG + Intergenic
939409565 2:141806820-141806842 AAATTCTAACAGGAATTAAATGG - Intronic
939598689 2:144161351-144161373 AGTTTCTTACAAGATGTAAGTGG - Intronic
939851044 2:147305229-147305251 AGAGGCCAAAAGGATGTAAATGG + Intergenic
940219198 2:151334233-151334255 ACAATCTAAGAGGATGTCAATGG - Intergenic
941006673 2:160254705-160254727 GGATTGTAACATGATGGAAAGGG - Intronic
942041385 2:172067481-172067503 AGATACCAACAGGATGTATGTGG - Intronic
942605410 2:177685343-177685365 AGATTCTAACATGAACCAAATGG + Intronic
943689500 2:190854913-190854935 AGGTTCTAACTGGCTCTAAAAGG - Intergenic
944012593 2:194991737-194991759 AAAATCTAACAGAATGTAACTGG - Intergenic
944578616 2:201113415-201113437 TGATTTTAAGAGGATGTAAATGG + Intergenic
945217627 2:207451461-207451483 GGATTCTACAAGGATGTACATGG - Intergenic
945423524 2:209669560-209669582 ACATTCTAAAAGGATGTCATTGG - Intronic
946224636 2:218257658-218257680 AGACTCTAACAGGAAGTGGAAGG + Intergenic
947060748 2:226162282-226162304 ACATTCTAACAGTATGTATTTGG - Intergenic
947939796 2:234041867-234041889 AGATTCTAACAGAAATAAAATGG + Intergenic
1170479970 20:16755678-16755700 AGATTCTACCTGGATTTTAAAGG - Intronic
1172082951 20:32357372-32357394 AGATTGGAAGAGGATGTGAAGGG - Intergenic
1172397037 20:34615345-34615367 AGATTCTTATAGGACTTAAATGG - Intronic
1172938410 20:38637729-38637751 AGCTTCTAGCAGGCTGTCAAGGG - Exonic
1173738644 20:45380090-45380112 AGATCACAACAGGCTGTAAAGGG + Intronic
1181991216 22:26838468-26838490 AGATTCAAGCAGGAAGTAAGAGG + Intergenic
1182273948 22:29172784-29172806 TGATTCTTACCGTATGTAAAAGG + Intergenic
949190268 3:1242578-1242600 AGATTTTAACGGGATGGTAATGG + Intronic
952258807 3:31719159-31719181 AAATTATAAAAGGATGTAAGGGG + Intronic
952791957 3:37207015-37207037 AGATTTTAATAGGATGGTAAGGG - Intergenic
955318805 3:57959832-57959854 AGATTCTACCAAGATGAAAATGG + Intergenic
958834744 3:99131801-99131823 AGAGCCTAACAGGAAGTAAGTGG - Intergenic
959186125 3:103050055-103050077 AGATTTAAAGAGGTTGTAAAAGG + Intergenic
959832417 3:110880449-110880471 AGATTCCAACTAGATATAAAAGG - Intergenic
959843989 3:111011921-111011943 GGATTCTAAATGGATTTAAAAGG + Intergenic
962425304 3:135264220-135264242 AGATTCAAACAGGGTTTAAAAGG - Intergenic
963406985 3:144878081-144878103 TGATTCTAACTGTATGAAAATGG + Intergenic
965092951 3:164184708-164184730 GGATTCTAACAGAAGGTGAAGGG + Intergenic
967404411 3:189099791-189099813 AGATTTCAGCAGGATGGAAAGGG - Intronic
967451656 3:189630762-189630784 AGCTTCTAAGGGGATGTGAAAGG + Intergenic
968241706 3:197094482-197094504 AGTTTTTAACTGGATATAAAAGG - Intronic
968537442 4:1143263-1143285 ACATTCTGACAGAATGAAAATGG - Intergenic
972714607 4:41633032-41633054 AGATTCTGAGAGGCTGTCAAAGG + Intronic
976651891 4:87444488-87444510 AGGTTCTAACAGTATGTGGATGG - Intronic
976894851 4:90097112-90097134 TGATTCAGACAGGGTGTAAAGGG + Intergenic
977151186 4:93514101-93514123 TGATTTTAACAGTATGTCAAAGG + Intronic
977967014 4:103164365-103164387 AAATTCTAATAGTATGTAAGGGG + Intronic
978054014 4:104240413-104240435 AGAGTATAACTGGATTTAAAAGG - Intergenic
983001074 4:162414794-162414816 AGATTCTAAAAGCTTGTTAAAGG - Intergenic
984177801 4:176440982-176441004 AGAGGCTAAAAGGAAGTAAAAGG + Intergenic
984506958 4:180631918-180631940 AAAGTTTAACAGGTTGTAAATGG + Intergenic
986518076 5:8583973-8583995 ACAGTGTAACAGGTTGTAAATGG + Intergenic
986851023 5:11813929-11813951 AGATTCTTACAGGATTTACCTGG - Intronic
987251572 5:16106368-16106390 ATATTTTAACAGGATTTACAGGG - Intronic
987972850 5:24972905-24972927 ACTTTCTAACAGAATGAAAAGGG - Intergenic
988905360 5:35782661-35782683 AGATAGTATCAAGATGTAAATGG + Intronic
989103603 5:37840845-37840867 AGATTACAACAGCATGAAAATGG - Intergenic
990824383 5:59880727-59880749 ACATTCTACCAGGGAGTAAATGG + Intronic
992075251 5:73186855-73186877 AGGCTTAAACAGGATGTAAAAGG - Intergenic
993551795 5:89282317-89282339 ATATTAAAACAGGATGGAAAGGG + Intergenic
993801246 5:92340988-92341010 TGAATCTAACAGTACGTAAAAGG - Intergenic
995971102 5:117972841-117972863 AAATTATAACAGAATGTGAAGGG + Intergenic
996821028 5:127627876-127627898 AGAGTCCAACAGGATGGGAAGGG - Intergenic
997801384 5:136866038-136866060 AGAGTCTCACAGGAAGTCAAGGG + Intergenic
999575467 5:152971945-152971967 ATATTCTAACAGCATAGAAATGG - Intergenic
999879563 5:155846540-155846562 AGAGTATAACAGAATGTGAAGGG - Intergenic
999906424 5:156145515-156145537 AGATTCAAAAAGGATATAGAGGG - Intronic
1001658202 5:173370259-173370281 CTATTCTAACTTGATGTAAATGG + Intergenic
1003782027 6:9439985-9440007 AGATTCTAACTGGGTATAAAAGG - Intergenic
1007308445 6:40925606-40925628 AGATTCTAACTGGATTGAGAAGG - Intergenic
1009767265 6:68095938-68095960 AGATAGTAATAGGATGAAAATGG + Intergenic
1010921943 6:81692740-81692762 AGATTCCAACAGGAAATAGATGG - Intronic
1011054317 6:83189828-83189850 AGATTCAACCATGATGCAAATGG - Intronic
1011703009 6:89972768-89972790 AAGTTCTCACAGGATGTAAAGGG + Intronic
1012593700 6:101015589-101015611 GGATTTTAGCAGGATGGAAATGG - Intergenic
1013158690 6:107520620-107520642 AGATGCTAACAGGAAATAAGAGG + Intronic
1013958192 6:115865665-115865687 AGATTTTAACTGGATGTCATTGG - Intergenic
1015545680 6:134358794-134358816 TGGTTCTAACATGATATAAATGG + Intergenic
1016295237 6:142566434-142566456 AGATGCTCAGAGGATGTAAATGG - Intergenic
1018558919 6:165080034-165080056 ACATTCTATCAGGAGGTATATGG - Intergenic
1020044808 7:5032874-5032896 ACATTATAATAGGATGTAACTGG + Intronic
1020691821 7:11364782-11364804 AGGTTCTAACAGGATGTTTTGGG + Intergenic
1021490049 7:21209890-21209912 AGTCTCTAACATGATTTAAAAGG - Intergenic
1021638408 7:22714004-22714026 AGAATCTCAGAGGATTTAAACGG + Intergenic
1026747308 7:73023449-73023471 ACATTATAATAGGATGTAACTGG + Intergenic
1026750958 7:73051592-73051614 ACATTATAATAGGATGTAACTGG + Intergenic
1026754607 7:73079702-73079724 ACATTATAATAGGATGTAACTGG + Intergenic
1026758259 7:73107736-73107758 ACATTATAATAGGATGTAACTGG + Intergenic
1027089146 7:75285750-75285772 ACATTATAATAGGATGTAACTGG - Intergenic
1027092789 7:75313678-75313700 ACATTATAATAGGATGTAACTGG - Intergenic
1027096432 7:75341645-75341667 ACATTATAATAGGATGTAACTGG - Intergenic
1027322913 7:77026042-77026064 ACATTATAATAGGATGTAACTGG + Intergenic
1029397540 7:100318602-100318624 ACATTATAAGAGGATGTAACTGG - Intronic
1029863846 7:103604045-103604067 AGATTCTCAGTGGATGAAAAGGG + Intronic
1030947009 7:115736173-115736195 AGATTTTAACAGTATGTCTAAGG - Intergenic
1031494357 7:122428201-122428223 AAATGTCAACAGGATGTAAAAGG - Intronic
1031698968 7:124900348-124900370 AGATTCTACCAGGAAGAAGAAGG - Intronic
1032309410 7:130769533-130769555 ACAATCTAAAAAGATGTAAATGG + Intergenic
1033888253 7:145975183-145975205 AGAATCATACAGGATGTTAAGGG - Intergenic
1033917475 7:146345775-146345797 AGACACTAACAAAATGTAAAGGG + Intronic
1034516574 7:151585546-151585568 ATATTCTAAAAAGATGAAAACGG - Intronic
1040857609 8:51964950-51964972 AGAAACCAACAGGATGTAACAGG - Intergenic
1041090081 8:54293820-54293842 AGATTCTTTCAGGCTATAAAAGG - Intergenic
1042732356 8:71951053-71951075 AGATTCTAAAAGCATGCAGAAGG - Intronic
1044323437 8:90832158-90832180 AGATTCTCAAAGCAAGTAAATGG - Intronic
1044586053 8:93869952-93869974 AGATTCAAACAGTATGCAACAGG + Intronic
1044720824 8:95144385-95144407 AAATACTAAAAGGAAGTAAAAGG - Intronic
1045801596 8:106108443-106108465 AAATTCTAAGAGGTTATAAAAGG - Intergenic
1046368158 8:113264288-113264310 AGATTCTAATTATATGTAAAAGG - Intronic
1048063646 8:130946435-130946457 AGATTTTAACAGGTAGCAAAAGG - Intronic
1048467660 8:134680499-134680521 GGATGGTAAAAGGATGTAAATGG + Intronic
1049450059 8:142655891-142655913 AGATTCTGATAAAATGTAAATGG - Intergenic
1051785994 9:20744189-20744211 AGTTTCTAAGAGGATGTTCAAGG - Intronic
1051932054 9:22397793-22397815 GGATTCTAACAGGACAGAAAAGG - Intergenic
1052480878 9:29024128-29024150 AAATTCTAACACAATGTAGAGGG - Intergenic
1052598310 9:30591549-30591571 ATATTTTAAAAGGATGAAAAGGG + Intergenic
1052609104 9:30746909-30746931 TGATTCTAACATTATCTAAATGG - Intergenic
1052844906 9:33326932-33326954 AGATTCTGATAAGATGTATATGG + Intronic
1053590360 9:39507863-39507885 AGAATCTAACAACATGGAAAGGG - Intergenic
1054575943 9:66857426-66857448 AGAATCTAACAACATGGAAAGGG + Intronic
1054986650 9:71269621-71269643 GCATTCTAACAGCATGAAAAAGG + Intronic
1055826810 9:80337021-80337043 TAATTCTAATAGAATGTAAATGG - Intergenic
1056044612 9:82703492-82703514 AGATTTTAACGGGATGGTAATGG + Intergenic
1056222640 9:84465442-84465464 TGATTTTGAAAGGATGTAAATGG - Intergenic
1058246920 9:102638289-102638311 ATACTCTATTAGGATGTAAATGG - Intergenic
1059772975 9:117445068-117445090 AGTTTCTAACAGCATCTAGAGGG + Intergenic
1059820358 9:117965989-117966011 AGATTATGAGAGGATATAAAAGG + Intergenic
1060005967 9:119999903-119999925 AGATTCTAGCAAACTGTAAAAGG - Intergenic
1060797259 9:126521392-126521414 AGAATATAACAAGTTGTAAAAGG + Intergenic
1188426534 X:30053676-30053698 AGAGTCTGACAGGGTATAAAGGG - Intergenic
1192055242 X:67767223-67767245 ATATGCAAACAGGCTGTAAATGG - Intergenic
1192600962 X:72463466-72463488 AGGTTCTAACCTGATGTATATGG + Intronic
1194300862 X:92184001-92184023 ATATTCTAATGGAATGTAAAAGG - Intronic
1195856821 X:109340754-109340776 AGATTGCAACAGGTTGTAATAGG + Intergenic
1197882371 X:131180463-131180485 AGATTTTAATAGGCTGCAAAAGG + Intergenic
1199138133 X:144277851-144277873 AGATACTATCAGGATTTCAATGG + Intergenic