ID: 911047233

View in Genome Browser
Species Human (GRCh38)
Location 1:93638673-93638695
Sequence CATGGTAAACAGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911047227_911047233 13 Left 911047227 1:93638637-93638659 CCAGAGCTGTACGCCAGGAACCG No data
Right 911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 328
911047228_911047233 0 Left 911047228 1:93638650-93638672 CCAGGAACCGAAGTCACTAGCTA No data
Right 911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 328
911047230_911047233 -7 Left 911047230 1:93638657-93638679 CCGAAGTCACTAGCTACATGGTA 0: 1
1: 0
2: 1
3: 3
4: 86
Right 911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911047233 Original CRISPR CATGGTAAACAGCAGGAGGA AGG Intronic
901748822 1:11393293-11393315 CATTCTAAACAGCAGGAAGGAGG - Intergenic
901792821 1:11663470-11663492 CATGGCAAACTGCAAAAGGACGG + Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902412813 1:16221304-16221326 CATGGTTAAAAGCATGTGGATGG + Intergenic
902758473 1:18565258-18565280 CATGGAAAACAGCCAGAGAAGGG + Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
904441027 1:30530886-30530908 CATGGTAAACAGGAAAAGGATGG - Intergenic
905342154 1:37286705-37286727 CATGGTAATGAGCTGCAGGAGGG - Intergenic
906013258 1:42549713-42549735 CATTGTACACAGTAGGAGTAGGG - Intronic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
906212076 1:44017558-44017580 GATGGTGACCGGCAGGAGGATGG + Intronic
907328896 1:53658750-53658772 CATGGTGCACAGCAGGAGGTAGG + Intronic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
908868892 1:68584862-68584884 CTTGATAAAGAGCAGGAGAAAGG - Intergenic
909963159 1:81873641-81873663 CATGTTAGATAGCAGGAGGCTGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910197515 1:84659257-84659279 CATGGAGATCAGCAGGATGAGGG + Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
912921966 1:113877148-113877170 CATAGGGAACAGTAGGAGGAGGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916685172 1:167137686-167137708 AATGGCAAAGAGCTGGAGGAGGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
918246317 1:182662824-182662846 TATGGTAAGCAGCTGGAGGAGGG - Intronic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919751871 1:201042803-201042825 CATAAAAAACAGCAGGATGAGGG - Intronic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920729381 1:208468482-208468504 CATTCTAAATAGCAGGAGAAGGG - Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922792993 1:228320769-228320791 GATGATAAACAGCAGATGGATGG - Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1070523328 10:77274095-77274117 CATGGTAAACAGTGGCAAGAGGG - Intronic
1072826247 10:98609781-98609803 CATAGGAAACAGCAGGAGCCTGG - Intronic
1073518118 10:104097427-104097449 CATGGTGAGAAGCAGGAGGCTGG - Intergenic
1073734891 10:106334704-106334726 CAAGGAAAACAACAGCAGGAAGG + Intergenic
1075417488 10:122275704-122275726 CAAGGAAAAAAGCACGAGGAGGG - Intronic
1075658419 10:124176541-124176563 CCTGGTGAACGGCAGGATGAGGG - Intergenic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1080306542 11:30843294-30843316 TATGGAAAATAGCAGAAGGATGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081720451 11:45285243-45285265 CATTGTAAAGAGCAGCAGAAGGG - Intronic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083422270 11:62560768-62560790 CATGGAAAACAGCCTGGGGAGGG - Intronic
1083629772 11:64089514-64089536 CATGGATAACAGGAGGAGGCTGG - Intronic
1084064569 11:66696231-66696253 GATGGTGAACAGCAGAAGAAAGG - Intronic
1086193739 11:84111782-84111804 CATGGGGAACAGCATGAGTACGG + Intronic
1088254746 11:107892702-107892724 CATTGTAAAAAGCAGTATGAAGG + Intronic
1089997459 11:122922509-122922531 CAAGGTAAACAGCAGAGGGGAGG + Intronic
1090350723 11:126106075-126106097 CATGGAGAACAGCAGAGGGAGGG - Intergenic
1090453645 11:126828518-126828540 ATTGGTAAACAGCAGGACCAGGG + Intronic
1090952262 11:131484050-131484072 AAAGGTAATGAGCAGGAGGAGGG + Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1091820191 12:3470462-3470484 CATGGTAGACAGCCTGGGGAAGG - Intronic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1094086679 12:26600877-26600899 CAAGGTAAATAGCAAAAGGAAGG - Intronic
1094263840 12:28531907-28531929 GATGGTAAATAGCATAAGGAAGG + Intronic
1096463289 12:51834610-51834632 AATGCCAAACAGCAGGAGGTCGG + Intergenic
1096837194 12:54358436-54358458 AATGGGAAAGACCAGGAGGAAGG - Intergenic
1097248251 12:57618385-57618407 CATGGCAAACAGCAGGATTCTGG + Intronic
1098307042 12:69112794-69112816 CATGGTAAACAGCAGAGAGTGGG + Intergenic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101416671 12:104514414-104514436 CATGGTGAAGAGGATGAGGAAGG - Intronic
1101574322 12:105983451-105983473 CATGGAGAACAGCAAGAGCAAGG + Intergenic
1102824943 12:115941158-115941180 CATGGTTCATAGCAGGAGGCTGG - Intergenic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1104894214 12:132153899-132153921 CCTGGGACACAGCAAGAGGACGG - Intergenic
1106459869 13:29959350-29959372 CCTGGAAAACAGTAGGAAGAAGG + Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1108092099 13:46859633-46859655 CATGGCCCAGAGCAGGAGGAAGG - Intronic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108455114 13:50605395-50605417 CATGCTAAACAGCAGGTACAAGG - Intronic
1110324957 13:74202961-74202983 ACTGGTAAAGAACAGGAGGAAGG + Intergenic
1111020634 13:82444780-82444802 CAAGGAAAAAATCAGGAGGAGGG - Intergenic
1111941175 13:94608806-94608828 CATAGTACACAGCAGCAGCAAGG - Intronic
1112092567 13:96097161-96097183 CAAGGTAACCATCAGGAAGAAGG - Intronic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1113267220 13:108633062-108633084 CATTGTTTGCAGCAGGAGGAAGG + Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1115665591 14:35541721-35541743 CAAGGTAAACAGCAATGGGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117756528 14:58980010-58980032 CATGGTTAGCAAGAGGAGGAAGG - Intergenic
1118428039 14:65688872-65688894 GAAGGTAAACACCAGGAAGAAGG - Intronic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1120522739 14:85543728-85543750 AATGGTAAACAGCATGGGAAAGG - Intronic
1120808419 14:88777673-88777695 AAAGTTAAAAAGCAGGAGGATGG + Intronic
1120862489 14:89267273-89267295 CATGGGAAACTGCTGCAGGATGG + Intronic
1121001057 14:90452432-90452454 CTTGGTAGATGGCAGGAGGATGG + Intergenic
1122431542 14:101651630-101651652 CATGGTAAACAGCATGCAGTTGG - Intergenic
1122743227 14:103883576-103883598 CATGACAGACAGCAGGAGGCCGG - Intergenic
1122743236 14:103883611-103883633 CATGACAGACAGCAGGAGGCCGG - Intergenic
1122743245 14:103883646-103883668 CATGACAGACAGCAGGAGGCCGG - Intergenic
1122743254 14:103883681-103883703 CATGACAGACAGCAGGAGGCCGG - Intergenic
1122743262 14:103883716-103883738 CATGACAGACAGCAGGAGGCCGG - Intergenic
1124204397 15:27704696-27704718 AATCATACACAGCAGGAGGATGG + Intergenic
1125021552 15:34991488-34991510 CATGGGAGACAGTAGGAGGCAGG + Intergenic
1127097441 15:55527010-55527032 CTTGGTGAATAGCAGGGGGATGG + Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1133327914 16:4953341-4953363 AATGGAACACAGCGGGAGGAGGG - Intronic
1134286205 16:12864165-12864187 CTTGACAAAGAGCAGGAGGAGGG + Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138512681 16:57517721-57517743 CATGGTCACCAGCAAGAAGAGGG - Intronic
1139446954 16:67003936-67003958 CATGGTGAGCCCCAGGAGGATGG - Intronic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1139911154 16:70398471-70398493 CATGATGAACACCAGCAGGAAGG + Exonic
1141065878 16:80913266-80913288 GATGGAAAAGAGCAGGTGGATGG + Intergenic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1145103307 17:20094501-20094523 GATGAAAAACAGCAGGAAGAGGG - Intronic
1146526702 17:33572883-33572905 CATGGTTGAAGGCAGGAGGAGGG - Intronic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1147599979 17:41739461-41739483 CATGGAAGACAGCAGGCAGAGGG - Intergenic
1149218250 17:54384404-54384426 GATGGTAGAAATCAGGAGGAGGG - Intergenic
1149878133 17:60259158-60259180 TATGGTAAGTAGCAGGAGGAAGG + Intronic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150459144 17:65332705-65332727 TAAGGTAGACAGCAGGAGTAAGG + Intergenic
1150911388 17:69390986-69391008 CATGGTACAAAGCAGGGGTAGGG + Intergenic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152608689 17:81305298-81305320 TGTGGGAAACAGCAGGAGGCCGG + Intergenic
1155585893 18:27364443-27364465 AATTGTAAATATCAGGAGGAAGG - Intergenic
1156801551 18:41120960-41120982 AATGACAAACACCAGGAGGAAGG + Intergenic
1158341149 18:56468029-56468051 CATGTTGAACAGCATGTGGAAGG + Intergenic
1162489149 19:10981614-10981636 CATGGCTAACAGCAGGAGAGAGG - Intronic
1163509178 19:17725263-17725285 CATGGAAAACAGCAGGTCGCTGG - Intronic
1164510470 19:28892657-28892679 CATGGTCAAAGGCAGGAGGGTGG - Intergenic
1164712559 19:30367880-30367902 CATGGGAAGGTGCAGGAGGAAGG - Intronic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1165743394 19:38216784-38216806 CTTGGTAGACAGCTTGAGGAAGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167504376 19:49863320-49863342 CGTGTAAAACAGCAGGAGGGAGG - Intronic
1167725701 19:51211482-51211504 CATCGTAGACGCCAGGAGGAGGG + Intergenic
1167727370 19:51225492-51225514 CATCGTAGACGCCAGGAGGAGGG + Exonic
1167752052 19:51387375-51387397 CATGGCCACCACCAGGAGGATGG + Exonic
1167781221 19:51600696-51600718 CTTGGTATACAGTAGGTGGATGG + Intergenic
926972656 2:18482352-18482374 CACGGTAAGCACCAGGAGGCAGG + Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928217584 2:29375124-29375146 CATGAGAAACAGCAGCAGCAAGG + Intronic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
931889369 2:66653940-66653962 CATGCTAAACAACATGAAGAAGG - Intergenic
932753591 2:74389094-74389116 CCTGGGAAACAGCATTAGGAAGG + Intronic
934511240 2:94946337-94946359 GATGGTGAGCAGCAGGAGTAGGG - Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
935701488 2:105815983-105816005 CCCGGTGAACAGCAGGTGGAAGG - Intronic
936184769 2:110294358-110294380 CATTGAGAACAGCAGTAGGAAGG + Intergenic
936515813 2:113180732-113180754 CATGGTTAACTGCATGTGGAAGG + Intronic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
939385788 2:141495352-141495374 CATGGTAATGAGCAGGAAAATGG + Intronic
939433431 2:142141453-142141475 CATGGTGGACAAGAGGAGGAAGG + Intergenic
941458941 2:165744248-165744270 CATGGTTGACAGCAGCACGAAGG + Intergenic
942090434 2:172484582-172484604 CATTGTTAACAGCAAAAGGAAGG + Intronic
942185341 2:173420182-173420204 CATGATAAACTCCTGGAGGAAGG - Intergenic
942326255 2:174779294-174779316 CATGGCACACACCTGGAGGAAGG - Intergenic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
942982295 2:182096669-182096691 CATGTTAATCATCTGGAGGAAGG - Intronic
944079618 2:195772038-195772060 GATGGTAACAGGCAGGAGGATGG + Intronic
944462652 2:199967478-199967500 AATGGTTAAAAGCAGCAGGATGG - Intronic
945971487 2:216235589-216235611 CATGCTACACAGCAGGAGATCGG - Intergenic
946568313 2:220992831-220992853 CATGTTAAACACCTGGTGGATGG - Intergenic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947753253 2:232543593-232543615 GATGGTCACCACCAGGAGGAAGG - Exonic
947820913 2:233068873-233068895 CCTGGAAGCCAGCAGGAGGAAGG + Intronic
947931727 2:233970311-233970333 GTAGGCAAACAGCAGGAGGAAGG - Exonic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1169893097 20:10474602-10474624 CATGGTTAACCCCAGAAGGAAGG + Intronic
1169936750 20:10891850-10891872 CATGCTAAACAGCAGAGGAAAGG + Intergenic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1171249115 20:23635373-23635395 CATGTGAAAGAGCAGGAGGCAGG + Intronic
1172018968 20:31899304-31899326 CATTCCAAACAGCAGGAGGTAGG + Intronic
1172250855 20:33478121-33478143 TATGGAAAAGAGCAGGATGAAGG - Intergenic
1174033875 20:47653615-47653637 CATGATACACAGCAGAAGGAGGG - Exonic
1174171151 20:48618931-48618953 CCTGTTAATCAGGAGGAGGAAGG + Intergenic
1174914216 20:54638162-54638184 CATGGTCTAGAGCAGAAGGAAGG + Intronic
1175247260 20:57589687-57589709 CATGGCACACAGCAGGAGTGGGG - Intergenic
1175825157 20:61932985-61933007 CATGACAAACAGCAGGACCATGG - Exonic
1175971917 20:62690781-62690803 CATGGTAAACGGAATGAGGTTGG + Intergenic
1176309710 21:5143037-5143059 CATGGCAGACAGCTGGGGGAGGG + Intronic
1177262515 21:18749290-18749312 AATGGGAAAGAGCAGCAGGAAGG + Intergenic
1178691869 21:34756477-34756499 TATGGGAAGCAGCAGGATGAAGG - Intergenic
1179847348 21:44118996-44119018 CATGGCAGACAGCTGGGGGAGGG - Intronic
1181113166 22:20613618-20613640 CATGGTCAGAAGCAGGAGGTGGG + Intergenic
1181823857 22:25497362-25497384 CATGATAAACAGCAGTGAGAGGG + Intergenic
1183578607 22:38708570-38708592 CCTGTTAAGCAGCAGGAGGCAGG + Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184381502 22:44147592-44147614 GAAGGTAAAAAGCAGGTGGAAGG + Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
949971295 3:9407448-9407470 CATGATAAACTGTAAGAGGAAGG - Intronic
950117110 3:10458261-10458283 GATGTTAAACAGCAGGAAAAAGG - Intronic
951201171 3:19876445-19876467 GATGGGAATCAGCAGCAGGATGG + Intergenic
951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG + Intronic
951881758 3:27486381-27486403 GCTGGCAAACAGCTGGAGGATGG + Intergenic
952141996 3:30490138-30490160 TATAGTAAACAACAGGAGAATGG + Intergenic
952945885 3:38477743-38477765 CATGGGCAACACCAGGGGGACGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
965084629 3:164079018-164079040 GATGGTAGACAGTGGGAGGATGG + Intergenic
965732085 3:171782981-171783003 CATGGTAAAGAGCAGGGGATGGG + Intronic
966473935 3:180322888-180322910 CATTGTAAACAGGCGGAGGCTGG + Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967182172 3:186915428-186915450 CATGCTAGAAAGCAGGAGGTGGG - Intergenic
969273411 4:6118366-6118388 CCTTTTAAACAGCAGGATGATGG - Intronic
970031046 4:11675140-11675162 AATTGTCAATAGCAGGAGGAAGG + Intergenic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971699781 4:29956164-29956186 CAAGGAAAACAGCTGAAGGAGGG - Intergenic
972849802 4:43035267-43035289 CATGTTAATCACCAGGATGATGG + Intergenic
975090534 4:70397386-70397408 GATGGTGTAGAGCAGGAGGAGGG + Intergenic
975662241 4:76699363-76699385 AAAGGTAAAAAGCAGGGGGAGGG - Intronic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976515047 4:85955298-85955320 CATGGAAAACTCCAGAAGGAAGG - Intronic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977711911 4:100135997-100136019 CATGGTAAAGGGCAGGAGGCAGG - Intergenic
979003840 4:115262587-115262609 CATGGAAAAAATCAGGAGGCTGG + Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980741834 4:136960603-136960625 CATGGTAAACAGAACGGTGAGGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981085114 4:140675732-140675754 CATTGTAAGCAGCAGCATGATGG + Intronic
982653292 4:158114502-158114524 CATGGAAAAGCACAGGAGGAGGG + Intergenic
983564887 4:169139499-169139521 CATGTTAATCAGCAGTAGAATGG - Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986047839 5:4057791-4057813 CTTGGAAAACACCAGCAGGATGG - Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
988000576 5:25342746-25342768 CATCTTATACAACAGGAGGAGGG + Intergenic
988368819 5:30339993-30340015 CATGGTAGACATCAGGCAGATGG - Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG + Intergenic
993376812 5:87158108-87158130 AATGGTAAACAACAGGATGTGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994942006 5:106336019-106336041 CATGGAAATCAACAGGAGAAAGG + Intergenic
995335647 5:110996130-110996152 CAAGGTAAACTACAGGAGGTTGG - Intergenic
996189892 5:120527028-120527050 AATGGTAAACAGCAGGACCTGGG - Intronic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999115004 5:149155178-149155200 GATGGTAAAAAGGAGGAGCAGGG - Intronic
1001628880 5:173159987-173160009 CATGGGGATCAGCAGGATGATGG + Exonic
1001847802 5:174937286-174937308 CATGGCAAACAGCAGGTGCTGGG + Intergenic
1002855605 6:1035539-1035561 GATGGTAAACAGCACCAAGAAGG + Intergenic
1003111145 6:3253112-3253134 CCTGGTCATCAGCAGGAAGAGGG - Intronic
1003404425 6:5816767-5816789 GATAGGAAACAGCAGGACGAAGG - Intergenic
1003740059 6:8926268-8926290 CATGATAAATAGCAGACGGAAGG - Intergenic
1004692044 6:18000692-18000714 TATGGAAAACAGTAGTAGGAAGG + Intergenic
1005980603 6:30833708-30833730 CCTGGCAATCAGCTGGAGGAAGG + Intergenic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007505992 6:42335827-42335849 CATGGGAAGCAACAGGAAGATGG - Intronic
1007556318 6:42769432-42769454 CCTGGTACACAGTAGGAGGGAGG + Intronic
1007654119 6:43441939-43441961 CCTGGTAGACAGCACGAGCAAGG - Exonic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007912516 6:45530132-45530154 TGTGGTAAAGTGCAGGAGGAAGG - Intronic
1008420536 6:51294141-51294163 CATGGTATTCAGCAGGTGGATGG - Intergenic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1011636156 6:89375673-89375695 CCTGTTAACCAGCAGGAGGCAGG - Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012477010 6:99624658-99624680 CATGGTTAAAAGGAGAAGGAAGG + Intergenic
1014143213 6:117967238-117967260 CATGGGAAACAACTGGAAGAAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017584374 6:155904178-155904200 CATAGTAAACTGCATGAGCATGG + Intergenic
1018578901 6:165290433-165290455 CATCAGACACAGCAGGAGGAAGG + Intronic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1019874010 7:3792674-3792696 GATGGGAGACTGCAGGAGGAGGG - Intronic
1020803276 7:12758215-12758237 CATGGTAAACAGGAGAAGCGTGG - Intergenic
1021781461 7:24110820-24110842 AATGGTCAACAGCAGGTGTAAGG + Intergenic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1022728167 7:32999159-32999181 GCTGGTAATCAGCTGGAGGAGGG + Intronic
1024991024 7:55234561-55234583 CCTGGGAAACAGGAGCAGGAGGG + Intronic
1025045486 7:55688861-55688883 GCTGGTAATCAGCTGGAGGAGGG - Intergenic
1026329855 7:69342410-69342432 AGTTGTAAACAGCAGGATGAAGG - Intergenic
1026894059 7:73999964-73999986 CAAGGTCAACAGCACGAGGCGGG + Intergenic
1028389737 7:90301471-90301493 GATGGTAGAGAGTAGGAGGAGGG - Intronic
1029995135 7:105000530-105000552 GATGGAAAAAAGGAGGAGGATGG + Intergenic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032480579 7:132243558-132243580 CATGTTTAAAATCAGGAGGAGGG - Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032813010 7:135441976-135441998 AATGGTAAAAGGTAGGAGGAGGG + Intronic
1033485338 7:141783594-141783616 TAAGGTCAACAGCAGGAGGAGGG + Intronic
1034817145 7:154182387-154182409 CATGGCAACCAGCATGAGGAGGG - Intronic
1034893049 7:154857472-154857494 CATGGCAAACACCTGGAGGCTGG - Intronic
1035212037 7:157336167-157336189 GATGGTGACCAGCAGGAGCAGGG - Intronic
1035953789 8:4053415-4053437 CATGATAAAAAGCAGGTGGTGGG - Intronic
1035981032 8:4372358-4372380 AATGGAAAACAGCATGTGGAAGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037171132 8:15893613-15893635 CATGGCAGAAAGCAGAAGGAAGG - Intergenic
1037607391 8:20449166-20449188 AATGGTCAACAGCAGGTGGAAGG - Intergenic
1038097681 8:24333595-24333617 CATGAGAAACAGCAGCAGGTAGG - Intronic
1039346502 8:36711099-36711121 CAAGGCATACAGCAGAAGGAGGG - Intergenic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1041485159 8:58368434-58368456 CATGGCAAACACCACGAGCAAGG - Intergenic
1041571896 8:59346631-59346653 CATGGTTATCAACAGGAGAAAGG - Intergenic
1041683096 8:60613267-60613289 CATGGGGAACAACAGGAGAAGGG - Intronic
1041855523 8:62449336-62449358 AATGGAATACAGCAGGTGGATGG - Intronic
1043861082 8:85317877-85317899 CATGGTCAATAGCAGTAGGAGGG - Intergenic
1044390580 8:91645850-91645872 CATGGTAAAAAGCACTATGAAGG - Intergenic
1044839031 8:96322419-96322441 CATGTAAGACAGCAGGAGGTGGG + Intronic
1045987405 8:108264574-108264596 CATGGCTGAGAGCAGGAGGAAGG - Intronic
1047979418 8:130164993-130165015 GATGATAAACAGCATGAGAAAGG + Intronic
1048395030 8:134006268-134006290 CATTGTAAAAAGGAGGTGGAGGG + Intergenic
1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG + Intergenic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049335718 8:142083666-142083688 CATGGAATACAGCAGGAGAGAGG + Intergenic
1049433039 8:142574095-142574117 CATGGGAAACACCAAGAGCACGG - Intergenic
1049697717 8:143991700-143991722 CATGGAAACTACCAGGAGGAGGG + Exonic
1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG + Intronic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051286421 9:15501954-15501976 CACGCTACACAGCAGGAGGGAGG + Intronic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051680051 9:19597939-19597961 CTATGTAAACAGCAGGAGGCAGG + Intronic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052849952 9:33372021-33372043 GAAGGTAAACAGCAGGAGACAGG + Intergenic
1055407372 9:75988903-75988925 CACCGTAAACAGCAGAAGGGTGG - Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056872585 9:90297233-90297255 GATGGCAAACAGCAGGAGTTTGG - Intergenic
1057049714 9:91914537-91914559 CAAGGTGACCGGCAGGAGGATGG - Intronic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1058482611 9:105412571-105412593 CATGATATACAGCAGGAGAAAGG + Intronic
1058588512 9:106535688-106535710 CATGGGCAACAGCAGAAGGCAGG + Intergenic
1059320066 9:113462472-113462494 CATGGCCAACAGCAGGTGGAAGG - Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187946133 X:24427896-24427918 CCTGGTTAACAGCAGAAGGAAGG - Intergenic
1188160837 X:26800333-26800355 CATAGTACACAGGAGGAGAAAGG + Intergenic
1188333562 X:28899935-28899957 CATGGTAATTAGCAGGAGTCAGG + Intronic
1189118759 X:38370936-38370958 CATGGCACCCAGCATGAGGAAGG - Intronic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1198054114 X:132976894-132976916 CATGGTATAGAGTAGGAGCAAGG + Intergenic
1199582575 X:149375152-149375174 AATGGTAAACAGTAAGAGAATGG - Intergenic
1200090376 X:153633175-153633197 CATGGTACACACCAAGATGAGGG + Intergenic