ID: 911048832

View in Genome Browser
Species Human (GRCh38)
Location 1:93652159-93652181
Sequence CTTTCAGAACAGAATGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911048832_911048836 25 Left 911048832 1:93652159-93652181 CCTTGTTCATTCTGTTCTGAAAG No data
Right 911048836 1:93652207-93652229 ATTCTAGTTACAGGGCTCCAAGG No data
911048832_911048837 26 Left 911048832 1:93652159-93652181 CCTTGTTCATTCTGTTCTGAAAG No data
Right 911048837 1:93652208-93652230 TTCTAGTTACAGGGCTCCAAGGG No data
911048832_911048835 17 Left 911048832 1:93652159-93652181 CCTTGTTCATTCTGTTCTGAAAG No data
Right 911048835 1:93652199-93652221 GTTCTCAGATTCTAGTTACAGGG No data
911048832_911048838 27 Left 911048832 1:93652159-93652181 CCTTGTTCATTCTGTTCTGAAAG No data
Right 911048838 1:93652209-93652231 TCTAGTTACAGGGCTCCAAGGGG No data
911048832_911048834 16 Left 911048832 1:93652159-93652181 CCTTGTTCATTCTGTTCTGAAAG No data
Right 911048834 1:93652198-93652220 TGTTCTCAGATTCTAGTTACAGG 0: 1
1: 0
2: 1
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911048832 Original CRISPR CTTTCAGAACAGAATGAACA AGG (reversed) Intronic
No off target data available for this crispr