ID: 911049663

View in Genome Browser
Species Human (GRCh38)
Location 1:93659963-93659985
Sequence CTATGAGCTCACTAAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911049656_911049663 10 Left 911049656 1:93659930-93659952 CCATGTGTATTCCCGTCTATGTC 0: 1
1: 0
2: 3
3: 9
4: 97
Right 911049663 1:93659963-93659985 CTATGAGCTCACTAAGAACAGGG 0: 1
1: 0
2: 3
3: 35
4: 258
911049658_911049663 -1 Left 911049658 1:93659941-93659963 CCCGTCTATGTCCCTTACTGGAC No data
Right 911049663 1:93659963-93659985 CTATGAGCTCACTAAGAACAGGG 0: 1
1: 0
2: 3
3: 35
4: 258
911049659_911049663 -2 Left 911049659 1:93659942-93659964 CCGTCTATGTCCCTTACTGGACT 0: 1
1: 0
2: 0
3: 15
4: 158
Right 911049663 1:93659963-93659985 CTATGAGCTCACTAAGAACAGGG 0: 1
1: 0
2: 3
3: 35
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911049663 Original CRISPR CTATGAGCTCACTAAGAACA GGG Intronic
900530875 1:3152633-3152655 CCATGAGGTCTCTAAGAGCAAGG + Intronic
900895429 1:5479867-5479889 GTCTGTGCTCACAAAGAACATGG - Intergenic
902529459 1:17081200-17081222 CAATAAGCTCACTAAGGACAGGG + Intronic
902631335 1:17706351-17706373 CTGGGAGCTCCCTAAGAACAAGG - Intergenic
902897207 1:19486875-19486897 CTATGAGCTCCCTGAGGACAGGG - Intergenic
903057084 1:20643512-20643534 ATGTGAGCTCCCTAAGAGCAAGG - Intronic
904282127 1:29427905-29427927 GTGTAAGCTCAATAAGAACAAGG + Intergenic
906076510 1:43055938-43055960 CTGTGAGCTCCCCAAGAGCAAGG - Intergenic
906253499 1:44329899-44329921 TTATGAGCTACATAAGAACATGG + Intronic
906282381 1:44563204-44563226 CTAGGAGCTCACCAGGAAAAAGG - Intronic
906639033 1:47430461-47430483 CTGTGAGCTCCTTGAGAACAGGG - Intergenic
906899153 1:49814420-49814442 CTATGAGCTCCCTGAGAGAAAGG + Intronic
907305634 1:53511505-53511527 CTGTGAGCTCGCTGAGGACAGGG + Intronic
907975183 1:59424673-59424695 CTGTGAGCTCCCTGAGGACAGGG + Intronic
908303507 1:62786308-62786330 GTATAAGCTCCCTAAGAGCAGGG - Intronic
908980788 1:69955216-69955238 CTATGAACTCACTGAGGGCAAGG - Intronic
909989222 1:82201546-82201568 CTATGAGCTCAGTGACAACATGG - Intergenic
911049663 1:93659963-93659985 CTATGAGCTCACTAAGAACAGGG + Intronic
913447852 1:118969148-118969170 CTTTGAGCTCAGTAGGTACAGGG - Intronic
913535590 1:119769006-119769028 CAAAGGGCTCACTCAGAACACGG + Intergenic
913683441 1:121208682-121208704 CTATGAGCTCTTTGAGAGCAGGG + Intronic
914035283 1:143996306-143996328 CTATGAGCTCTTTGAGAGCAGGG + Intergenic
914154169 1:145071664-145071686 CTATGAGCTCTTTGAGAGCAGGG - Intronic
914963190 1:152225332-152225354 CTATGAGCTCCTTGAGAATAAGG + Intergenic
916798345 1:168189068-168189090 CTCAGTGCTCACTAAGGACAAGG - Intronic
916955847 1:169833717-169833739 CTATTAGCCCTCTAAGAGCACGG + Intronic
917483679 1:175435035-175435057 CTGTGAGCTCCTTAAGGACAAGG + Intronic
919728373 1:200898097-200898119 CTGAGAGCCCACTGAGAACAGGG + Intronic
919799229 1:201343070-201343092 CTCAGATCTCACTGAGAACATGG - Intergenic
919856666 1:201710979-201711001 CTATGTGGGGACTAAGAACATGG - Intronic
920266300 1:204726003-204726025 CTATAAGCTTATTAAGAGCACGG - Intergenic
920470750 1:206227191-206227213 CTATGAGCTCTTTGAGAGCAGGG + Intronic
920751548 1:208682725-208682747 CTAAGTGCTCCCTAAAAACAAGG + Intergenic
921334354 1:214071471-214071493 CTATGAGATCAGGAAGAAAATGG - Intergenic
921868920 1:220116304-220116326 CTATTATCTCATTAAAAACAGGG - Intronic
922083641 1:222324323-222324345 CTCTGAGCTCATTGAGTACAGGG - Intergenic
924140956 1:241022786-241022808 AAATCAGCTCACTAAGACCATGG - Intronic
1064327118 10:14361768-14361790 ATATCAGCTCCCTCAGAACAAGG - Intronic
1065800964 10:29351966-29351988 TTATAAGCTCATTAAGAACAGGG + Intergenic
1067195842 10:44117236-44117258 CTATCAGCTCACCAAAAAAAGGG + Intergenic
1068167333 10:53347828-53347850 CTCTGAGCACACTGAAAACATGG - Intergenic
1068490475 10:57717467-57717489 CTATGAGCTAACCAACAACTGGG - Intergenic
1068931900 10:62599097-62599119 CAAAGACATCACTAAGAACATGG + Intronic
1069487980 10:68837104-68837126 CTATGAGCTCCTTGAGGACAGGG - Intronic
1071014456 10:80978398-80978420 CTATAAAGTCAATAAGAACAAGG - Intergenic
1071400917 10:85269802-85269824 CTATGAGCTATGTAAGGACAGGG + Intergenic
1071756899 10:88552338-88552360 CTGTGAGCTCCTTAAGAACTAGG + Intronic
1072156873 10:92731524-92731546 CTATAAGTTCCCTGAGAACAGGG + Intergenic
1072243264 10:93517704-93517726 CTATGAGCATAACAAGAACATGG - Intronic
1073448114 10:103592979-103593001 CTCTGAGCTCCCCAGGAACAAGG + Intergenic
1073777698 10:106804870-106804892 ATATAAGCGCACTAAGAAAATGG + Intronic
1074065693 10:110010806-110010828 CCATGAGCTCAATAGCAACAAGG - Intronic
1076358722 10:129871341-129871363 CTTTGAGCTCACAAAAAGCAAGG - Intronic
1078535584 11:12170836-12170858 CGGTGAGCTCCCTAAGGACAGGG + Intronic
1080835784 11:35939641-35939663 CTGTGAGCTCCCTAAGGACAGGG + Intergenic
1081792362 11:45797262-45797284 CTGTGAGCTCTCTAAGCACTGGG - Intergenic
1083383387 11:62287716-62287738 CTTTGAGCTCACTTTCAACAAGG - Intergenic
1085846001 11:80065820-80065842 TTGTGAGCTCACTGAGGACAGGG - Intergenic
1086030889 11:82353838-82353860 CTATGAACTCACTGAGGATAGGG + Intergenic
1086105135 11:83139266-83139288 CTGTGATCTTACTAAGAACTTGG - Intergenic
1086106362 11:83151834-83151856 CTATGAGCTCCTTGAGAGCATGG + Intergenic
1089206846 11:116771300-116771322 CTATAAGCTCCACAAGAACAGGG + Intronic
1089241315 11:117083165-117083187 CTAAGAGCTCAATTAGAGCAGGG + Intronic
1089552240 11:119288836-119288858 CTATGCGCACACTGAGAATAAGG + Intronic
1091160646 11:133416589-133416611 CCATGAGCTCCTTGAGAACAAGG + Intronic
1092018629 12:5181363-5181385 TTGTGAGCTCTTTAAGAACAAGG + Intergenic
1092813191 12:12290422-12290444 CTATGAACTCAATAAGAGCCTGG + Intergenic
1094047248 12:26180567-26180589 CTATGTGCTCAGAAAGCACAGGG - Intronic
1094195695 12:27747360-27747382 CTGTGAGATCACTGAGGACAAGG + Intronic
1094382670 12:29860160-29860182 CTATGAGAACACTAAGAAACAGG - Intergenic
1095149191 12:38770975-38770997 CTATGTGTTCATTAAAAACAAGG + Intronic
1095638580 12:44460078-44460100 CTGTGAGTTCACCAAGAACAAGG + Intergenic
1096945002 12:55395107-55395129 CTCTGGGTTCACAAAGAACATGG + Intergenic
1098190444 12:67942813-67942835 CTGTGAGCTCCCTAAGGACAGGG - Intergenic
1100023955 12:90105003-90105025 CAATAAGCTCTGTAAGAACAGGG - Intergenic
1101746836 12:107548296-107548318 CTATAAGCTCTTCAAGAACAGGG + Intronic
1101824185 12:108207880-108207902 CTGTGAGCTCATTAAGGCCAGGG - Intronic
1101846968 12:108370460-108370482 TTCTGAGCTCACTAGGAACCGGG + Intergenic
1103479447 12:121241601-121241623 CAGTGACCTCCCTAAGAACAGGG - Intronic
1107299344 13:38948711-38948733 ACATGAGCTCCCTAAGGACAGGG - Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1107706386 13:43110710-43110732 TTATGAGCTCTCTGAGAGCAAGG + Exonic
1108676755 13:52743686-52743708 CTATAAGCTCATCAAGAGCAGGG - Intergenic
1112960262 13:105115719-105115741 CTATGATATCAGCAAGAACAAGG + Intergenic
1114743932 14:25126236-25126258 CTACAAGCTCATTAAGATCAGGG - Intergenic
1115343517 14:32317957-32317979 ATATGAGCTCCCCAAGGACAGGG + Intergenic
1115457138 14:33616523-33616545 CTGTGAGGTCAGGAAGAACAGGG - Intronic
1116149896 14:41127620-41127642 TTATGAGCTTACTCAGAACAAGG + Intergenic
1116918351 14:50547421-50547443 CTGTGAGCTGAATAAAAACAAGG + Intronic
1117767449 14:59097647-59097669 CTATGAGCAAACTAAGAGCTGGG + Intergenic
1118451469 14:65906305-65906327 TTATGAGCTCACATAGAGCAAGG + Intergenic
1118552919 14:66976732-66976754 CTATAAGCTCCTTAAGAACAGGG - Intronic
1118841725 14:69518367-69518389 CTGTGAGCTCCCTGAGAGCAAGG + Intronic
1121678557 14:95774020-95774042 CTCTGAGCTCTCTAAGGACAAGG + Intergenic
1125703308 15:41708141-41708163 CAATGATTTCACTAAGATCAAGG + Exonic
1126440006 15:48677103-48677125 ATATGAGCTCTCAAAGAATAGGG + Intergenic
1126870595 15:52982877-52982899 CTATAGGCTCACCAAGAATAAGG + Intergenic
1131931860 15:97451458-97451480 CTATAAACTCACTAAGGACAGGG + Intergenic
1134135019 16:11672087-11672109 CTATGATCCCCCTGAGAACAGGG + Intronic
1135404516 16:22188886-22188908 CTAGGAGCTCCCTAAGGGCAAGG - Intronic
1135413294 16:22250866-22250888 CGATGGGCTCAGGAAGAACAGGG + Intronic
1135484502 16:22852243-22852265 CTAGGAGCTCATTTAGACCAGGG - Intronic
1137298151 16:47117617-47117639 GTATGAGCTCAATAGGAAAATGG - Intronic
1138130173 16:54472660-54472682 CTATGAGCTTCCTAAGAGCCAGG - Intergenic
1138747808 16:59383849-59383871 CTGTGAAGTCAATAAGAACATGG + Intergenic
1139791977 16:69445365-69445387 CTATGAGCTCCCTGAGGATAAGG - Intronic
1140042004 16:71414243-71414265 CTGAGAGCTCACTGAGTACACGG + Intergenic
1140331729 16:74064142-74064164 CTGTGAACTCTCTAAGAGCAGGG - Intergenic
1142434137 16:90046603-90046625 CGAAGAGCTCACTGAGATCACGG - Intergenic
1144129353 17:12230957-12230979 CTTTGACCTCATTAAGAAGATGG + Intergenic
1144358343 17:14467441-14467463 CTATGAGCTATGTAAGAACAGGG - Intergenic
1147721366 17:42541547-42541569 CTAAGAGCTAGCTATGAACAAGG + Intronic
1151643788 17:75415765-75415787 CTATGAGCTCCTCAAGCACAGGG + Intergenic
1151761021 17:76103360-76103382 CGACCAGCTCACTAAGAACATGG - Exonic
1153409455 18:4777501-4777523 CTGTGAGCCCCCTGAGAACAAGG - Intergenic
1155391455 18:25341838-25341860 CTATAAGCTCCATAAGAGCAAGG + Intronic
1157103326 18:44749921-44749943 CTTTGAGCTCACAATGAAGAAGG + Intronic
1157365061 18:47057193-47057215 CTCTGAGATCACTCTGAACATGG + Intronic
1157742155 18:50103070-50103092 CCATGAGCACAGTCAGAACAAGG - Intronic
1158226870 18:55210534-55210556 CTATTAGCTCTGTGAGAACATGG - Intergenic
1158283661 18:55854853-55854875 CTGTGAGCTCCCTAGGGACAAGG - Intergenic
1158539769 18:58342578-58342600 CTGTGAGCTCATTAAGAGCAAGG + Intronic
1158908635 18:62038267-62038289 CACTGATCTCTCTAAGAACACGG - Intergenic
1160363098 18:78300966-78300988 CTATGAGCTCAGGAACCACAGGG + Intergenic
1161132783 19:2601476-2601498 CAATGAGCTCCCCAGGAACAAGG + Intronic
1165923437 19:39312903-39312925 CTATAAGCTCCCTGAGGACAGGG + Intronic
1167684547 19:50948511-50948533 GTATGAGCTCTGTGAGAACAGGG + Intronic
926965857 2:18410001-18410023 ATATGAGCTCAGTAAACACAAGG - Intergenic
927444217 2:23143465-23143487 CTATGAGCCCACATAGAACTTGG - Intergenic
927484600 2:23479817-23479839 CCCTGAGCTCACTGAGGACAGGG + Intronic
927578437 2:24219967-24219989 CTGTGGGCTCACTGAGAACAGGG - Intronic
928382547 2:30831980-30832002 CTAAGAACTCAGGAAGAACAAGG - Intergenic
930084443 2:47484386-47484408 CTATAAAATCACTAAGAAAAGGG + Intronic
930770010 2:55121221-55121243 CTGTGAGCTCCCTGAGAGCAGGG - Intergenic
931586262 2:63832791-63832813 CTATAAGCTCTTTAAGAGCAAGG - Intergenic
932246546 2:70201736-70201758 TGATGAGCTCACTTATAACATGG - Intronic
932555354 2:72819010-72819032 CTATAAGCTCAATAAGGATAGGG + Intronic
935307971 2:101756249-101756271 CTATGACTTCATTAAGATCAAGG - Intronic
936285542 2:111178552-111178574 CTATGTGCTCCATGAGAACAAGG + Intergenic
938108236 2:128547588-128547610 CTATGAGCTCTTTAAAAGCAGGG - Intergenic
939430089 2:142093229-142093251 CTATGAGTTTCCTGAGAACAAGG + Intronic
939480953 2:142746534-142746556 CCATGAGCTCCCAAAGAAGACGG - Intergenic
941156624 2:161986923-161986945 CTATGTGCTCACTAAAGGCAGGG - Intergenic
946151013 2:217770666-217770688 CAATGGGCTCACTAACAACGTGG + Intergenic
947505584 2:230705983-230706005 CTATAAGCTCACTGAGAGCAAGG + Intergenic
947982716 2:234424184-234424206 CTATAAGCTCCTTGAGAACAGGG + Intergenic
1169801167 20:9514210-9514232 CCATGAGCTCATTGAGAGCAGGG + Intergenic
1170046233 20:12088386-12088408 CCATGGGCTCACAAAGAAGAAGG - Intergenic
1170102774 20:12720635-12720657 CTTTGAGCTCACAAAGCCCAGGG - Intergenic
1171073715 20:22101447-22101469 CTGTGTTCTCACTGAGAACAGGG - Intergenic
1171074711 20:22110755-22110777 GTATGAGCTCCGTGAGAACAGGG - Intergenic
1172002385 20:31789234-31789256 ATGTGAGCTCCCTGAGAACAGGG + Intronic
1173831404 20:46091412-46091434 CCATGAGCTCCCTAAGCACAAGG - Intergenic
1174416254 20:50369294-50369316 CTGTGAGCTCCCTAAGGACAGGG + Intergenic
1175130204 20:56782919-56782941 CTATGAGCTTTCTGAGAATACGG + Intergenic
1178689116 21:34736388-34736410 CTATGAGCTCTTGAAAAACATGG - Intergenic
1181472761 22:23151044-23151066 CTATGAGCTCCTTAGGAAGAGGG - Intronic
1182490206 22:30666710-30666732 CTTTGAGCTCCCTGAGAAAAGGG - Intronic
1183085311 22:35483465-35483487 CTGTAAGCTCCCTAAGCACAGGG + Intergenic
1183384066 22:37504870-37504892 CTGTGAGCTCCCTGAGGACAGGG - Intronic
1183567162 22:38623731-38623753 CCATGAGTTCCCTGAGAACAGGG + Intronic
1183844293 22:40528097-40528119 GTATGAGATCACCAAGACCAGGG + Intronic
1185132765 22:49049224-49049246 ATATGAGATCTGTAAGAACAGGG - Intergenic
949791830 3:7801246-7801268 CTGTGTGCTCCCTAAGAATAGGG + Intergenic
949857570 3:8475875-8475897 CCATGAGCTCACTGAAGACAGGG - Intergenic
949866767 3:8553438-8553460 ATCTGGGCTCACTCAGAACATGG - Intronic
949986450 3:9544994-9545016 CTATGAGCTCCCTGGGAGCAAGG + Intronic
950343795 3:12273173-12273195 CTATGAGCTCCCTAAAAGCAGGG + Intergenic
951156987 3:19367490-19367512 CTTTGAGCTCTCAGAGAACATGG + Intronic
951336850 3:21433952-21433974 CTTTGAGCTCACTAAGGGCACGG + Intronic
951488059 3:23236171-23236193 AGATGTACTCACTAAGAACAGGG - Intronic
954652711 3:52175193-52175215 CTATGAGCTCCCTGAAAGCAGGG + Intergenic
955104149 3:55879954-55879976 CTTTCTGTTCACTAAGAACAGGG + Intronic
955813784 3:62820547-62820569 ATATGAGCTCGGTAAGGACAAGG + Intronic
962618891 3:137157201-137157223 CTATGAGCTCCTCAAGAACAGGG - Intergenic
963085673 3:141434089-141434111 CTATGAGCTCCTTGAGTACAGGG - Intronic
963994959 3:151697787-151697809 TAATCAGCTCACTTAGAACAAGG - Intergenic
964073668 3:152666704-152666726 GATTGAGCTCATTAAGAACAAGG + Intergenic
965324603 3:167288040-167288062 CTGTGAGCTCAATAAGATCAGGG + Intronic
965763131 3:172102140-172102162 CAATTAGCTCGCTAAGAGCATGG + Intronic
965875404 3:173312408-173312430 TTTTGAGCTCAGTAAGGACATGG + Intergenic
966016166 3:175140358-175140380 CTATAAGCTCTCTGAGGACAGGG - Intronic
966462454 3:180191999-180192021 CTATGTGCTCACTAAGTATTTGG - Intergenic
966623568 3:181992254-181992276 CTGTGAGCTATTTAAGAACAGGG + Intergenic
966887364 3:184384138-184384160 CTGTGAGCTTGCTAAGCACAGGG - Intronic
970328224 4:14951231-14951253 ATATGTTCTCACTAAGAAGAGGG + Intergenic
970899404 4:21141341-21141363 CTGTGAGTGCCCTAAGAACAGGG + Intronic
971340531 4:25764850-25764872 CTATGAGGACACTAACAATAAGG - Intronic
971956902 4:33432183-33432205 GTATTAGCAAACTAAGAACATGG + Intergenic
972090088 4:35270346-35270368 CTATAAGCCAACGAAGAACAAGG - Intergenic
972135142 4:35883819-35883841 CTGTGAGCTACCTGAGAACAGGG - Intergenic
975399047 4:73913348-73913370 ATTTGAGCTTACTAAAAACAGGG + Intergenic
975881687 4:78916514-78916536 CTCTGAGCTCCTTAAGAATAGGG - Exonic
977350457 4:95878700-95878722 CTATGAGCCCACTTAGTACTTGG + Intergenic
978985361 4:115005562-115005584 CTATGAGCTCAATAAAAACAAGG - Intronic
979220162 4:118213986-118214008 CTGTGAGCTCATCAAGAGCAGGG - Intronic
979745189 4:124204737-124204759 TTATGAGCTCTGTAAGACCAAGG - Intergenic
980837484 4:138214851-138214873 CTATGAGCTCCTTAAGACTATGG - Intronic
981045459 4:140261087-140261109 CTATGAGCTTCCTAAGAATGAGG - Intronic
981878694 4:149580979-149581001 ATATAAGCTCAATAAGGACAGGG - Intergenic
983197075 4:164818630-164818652 CTTTAAGCTCATAAAGAACATGG + Intergenic
983327962 4:166284480-166284502 CTATGAGCTTCCTAAAAATAAGG - Intergenic
983467819 4:168116848-168116870 CTGTTAGGTCACAAAGAACATGG - Intronic
984587822 4:181582830-181582852 CAATGACCTCACTAACAAGATGG - Intergenic
986514370 5:8545603-8545625 CCATGAGTTCACTATGTACAAGG - Intergenic
989540050 5:42607499-42607521 CTATAAGCTCTCTCAGAATAAGG - Intronic
990812729 5:59747298-59747320 CTCTAAGCTCACTAAGGAAAAGG - Intronic
992090605 5:73312752-73312774 GTGTGAGCACACTAAGAACCAGG + Intergenic
993116803 5:83728871-83728893 CTATGGCATCACTAAGAACAAGG - Intergenic
995511809 5:112918200-112918222 CTTTGAGCTCTTTGAGAACAGGG - Intronic
995898621 5:117044114-117044136 CCATGAGCTCAATCAGAATAGGG + Intergenic
997272063 5:132548304-132548326 CTATGAGCTCCTTGAGAATAAGG + Intronic
997691648 5:135831399-135831421 CTGTGAGCCCACTGAGAAGAGGG - Intergenic
997877450 5:137561933-137561955 CTGTGAGCTCATTGAAAACAGGG - Intronic
998358554 5:141563335-141563357 ATATGACCTCCATAAGAACAGGG + Intronic
1000048368 5:157540568-157540590 CTGTGAGCTCCCCAAAAACAGGG + Intronic
1000961039 5:167601609-167601631 CTATGAACACACTAAAATCAAGG - Intronic
1001566258 5:172701329-172701351 CTATCAGCTCCTCAAGAACAGGG + Intergenic
1004525181 6:16400721-16400743 CTGTAAGCTCATTGAGAACAAGG - Intronic
1004909762 6:20271637-20271659 CTATGAGCTACCTGAGACCAGGG - Intergenic
1008593443 6:53017279-53017301 CCATAAGCTCACTCAGGACAAGG - Intronic
1009569229 6:65360735-65360757 CTGTGAGCTCAGTGAGAGCAAGG - Intronic
1011058589 6:83235301-83235323 CTATCAGCTTCCTAAGATCAAGG + Intronic
1011415640 6:87117278-87117300 ACATGAGCTCACTAACTACAAGG + Intergenic
1012506826 6:99956319-99956341 CTGTGAGATTACTATGAACAGGG - Intronic
1012533964 6:100273078-100273100 CTATGAGGTCACTAAGAGATAGG - Intergenic
1012951627 6:105524070-105524092 CTATGAGCTCCTTAAGGACAAGG - Intergenic
1014373891 6:120647417-120647439 CTTTAAGCTCCTTAAGAACAAGG + Intergenic
1014507192 6:122273859-122273881 CTATAAAATGACTAAGAACAAGG + Intergenic
1015033110 6:128620049-128620071 CTATGAAGTCAATAAGAACAAGG - Intergenic
1015540195 6:134306021-134306043 CTATGAGCTCTATGAGGACAAGG - Intronic
1015613943 6:135055112-135055134 CTATGCGCTCAGTAAGAGCAGGG + Intronic
1017115520 6:150972780-150972802 ATATTAGCTCACAAAAAACAAGG - Intronic
1017658752 6:156653978-156654000 CTATAAGCTCCATGAGAACAGGG + Intergenic
1020606121 7:10338950-10338972 CTATGATCTCACTGAGACCTGGG + Intergenic
1022106300 7:27199972-27199994 CGACGAGCTCAACAAGAACATGG - Exonic
1022455760 7:30556899-30556921 CTATGAGCTCCTTAAAAACAAGG + Intergenic
1023101449 7:36722295-36722317 CTATGACCTCACTGGGAACAGGG + Intronic
1024257730 7:47551008-47551030 ACATGAGCTCACTCAGAAAAAGG + Intronic
1024921927 7:54566372-54566394 CTATTAGCTCATTAAAAGCAAGG - Intronic
1025071222 7:55900612-55900634 CTATGATCTCACTTAAAACGTGG + Intronic
1027414478 7:77960367-77960389 ATATGACCTCACTAAAAAAATGG - Intergenic
1028361915 7:89978491-89978513 ATATCAGCTCAGTAAGAAGAGGG - Intergenic
1028390602 7:90312052-90312074 CTATAAGCTCTCTAAGAACAAGG + Intergenic
1028583083 7:92426612-92426634 CTATGAGATAAGTAAGATCATGG - Intergenic
1030428146 7:109406716-109406738 CTATGAGCTCCATAATAACAAGG - Intergenic
1030565949 7:111156017-111156039 CTATGACAACACAAAGAACATGG - Intronic
1031829225 7:126605937-126605959 CTGTGAGTTCCCTGAGAACAGGG + Intronic
1035956804 8:4089212-4089234 CTATAAGCTCCATAAGGACATGG + Intronic
1038059750 8:23899798-23899820 CCATGAGCTCTTTGAGAACAAGG - Intergenic
1039557748 8:38488786-38488808 CTATGAGCTGGCCAGGAACATGG - Intergenic
1041649274 8:60285721-60285743 CAATGAGCTCCCAAAGAGCAAGG + Intergenic
1042109081 8:65360087-65360109 CTGTGAGCTGTCTATGAACAGGG + Intergenic
1043312204 8:78874800-78874822 CTTTGACATCAATAAGAACAAGG - Intergenic
1044054084 8:87546382-87546404 CTAAGAGCTCACAAAGTAAAAGG + Intronic
1044104696 8:88189194-88189216 CTATGAGCTCAGTAAGGAAGGGG - Intronic
1044110059 8:88261996-88262018 CTATGAGCTCATTAAGGCAAAGG + Intronic
1045226145 8:100247723-100247745 GTATGAGCTCATTAAAAGCAGGG - Intronic
1047051634 8:121119021-121119043 CTATGACCTCACATAGAAGAAGG - Intergenic
1047916346 8:129587869-129587891 CTCTCAGCTCACTCAGACCATGG + Intergenic
1048052708 8:130833745-130833767 CTATGAGCAAACTGAGCACAGGG + Intronic
1048107778 8:131430156-131430178 CTATAAGCTCTCTGAGAGCAAGG - Intergenic
1050061589 9:1715212-1715234 CTGTAAGCTCCCTAAGGACAGGG + Intergenic
1050271123 9:3946219-3946241 CTGTGAGCTTTATAAGAACAAGG + Intronic
1050291401 9:4159133-4159155 CTATAAGCTCCTTGAGAACAGGG + Intronic
1051558576 9:18413011-18413033 CTATGAGCCTACTAAAAACTTGG - Intergenic
1052730423 9:32278749-32278771 CTAGGAACTCACACAGAACAGGG + Intergenic
1052942860 9:34144193-34144215 CTATGAGCTCCTTAAGGACAGGG - Intergenic
1053727621 9:41020226-41020248 AAATGAGCTCCCTGAGAACAGGG - Intergenic
1054700895 9:68411880-68411902 AAATGAGCTCCCTGAGAACAGGG + Intronic
1054705753 9:68460344-68460366 CTGAAAGCTCACTAAGCACAGGG - Intronic
1055071202 9:72167966-72167988 CTATAAGCTCCCTGAGAGCAGGG + Intronic
1055412055 9:76041376-76041398 CAAGGAGCTCACTAATACCAGGG - Intronic
1056862829 9:90202978-90203000 CAAGGAGCTCCCTAAGAATAGGG - Intergenic
1059428533 9:114236302-114236324 CAGTGAGTTCCCTAAGAACAAGG + Intronic
1059624667 9:116049870-116049892 CTGTGAGCTCTCTGAGAATAGGG + Intergenic
1060027601 9:120186135-120186157 CTATGAGCTCCTTGAGAGCAGGG + Intergenic
1187707430 X:22022501-22022523 CTGTGACCTTACTAAGAAGAGGG + Intergenic
1187878673 X:23826071-23826093 CTATGGGAACACTAAGAAGAAGG + Intergenic
1189533101 X:41907626-41907648 CTATGTGCTCACTAACATCCTGG + Intronic
1190446017 X:50525194-50525216 ATATGAGCTTCATAAGAACAAGG - Intergenic
1190733491 X:53239950-53239972 CTGTGAGCTCCCTGAGAACAGGG + Intronic
1190913469 X:54792658-54792680 CTCTGAGCTCCCTGAGGACAAGG - Intronic
1191025191 X:55906979-55907001 GTATAAGCTCAGTAAGAGCAGGG - Intergenic
1191171436 X:57451438-57451460 CTAGGAGCTCCCTGAGAGCATGG - Intronic
1192207088 X:69103505-69103527 CTATGTGCTCACCAAGAGCAGGG + Intergenic
1192292503 X:69812572-69812594 CTGTGAGCTCTTTAAGAGCAAGG - Intronic
1192558662 X:72110354-72110376 CTGGGAGCTCCCTAAGGACAGGG + Intergenic
1195327653 X:103771075-103771097 CTGTAAGCTCTCTCAGAACAAGG + Intergenic
1195644779 X:107217442-107217464 CTATTAGCTCAATCAGAACAGGG - Intronic
1197705283 X:129630331-129630353 CTAGGAGCTCACAAAGGGCAGGG - Intergenic
1198043049 X:132873591-132873613 CTATGAGCTTCCTAAGAGCAGGG - Intronic
1198801465 X:140452136-140452158 CTGTGAGCTCCTTAAGAGCATGG - Intergenic
1199514861 X:148664630-148664652 CTGTGAGCTCACTAAGAGCAAGG + Intronic
1200236022 X:154468107-154468129 CAATGAGCTGACTAACCACATGG + Exonic
1200603107 Y:5231147-5231169 AAATGAACTCACTAAGAACTAGG - Intronic
1201400428 Y:13598778-13598800 TTATGTGCTCACAAAGAACTTGG + Intergenic