ID: 911050488

View in Genome Browser
Species Human (GRCh38)
Location 1:93666847-93666869
Sequence TCTCACATGTTGATGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911050488_911050493 21 Left 911050488 1:93666847-93666869 CCAGACTCCATCAACATGTGAGA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 911050493 1:93666891-93666913 CCGTCATTGAACGTGATCTCAGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911050488 Original CRISPR TCTCACATGTTGATGGAGTC TGG (reversed) Intronic
900919392 1:5661139-5661161 TCTAATATGTTGTTGGAGGCAGG - Intergenic
903461078 1:23521444-23521466 TCTCAGATCTGGAAGGAGTCCGG + Intronic
903757357 1:25671947-25671969 GCTCACATGATTATGGAGGCTGG + Intronic
906695523 1:47820703-47820725 TCCCACCTGTTGATGGAGGACGG - Intronic
909891781 1:81016202-81016224 GCTCACATGTTTATGGAGGCTGG - Intergenic
910441760 1:87260263-87260285 TCTCACATTTTGACGATGTCAGG + Intergenic
911050488 1:93666847-93666869 TCTCACATGTTGATGGAGTCTGG - Intronic
911303995 1:96210760-96210782 TTTCAAATTTTTATGGAGTCAGG - Intergenic
911537630 1:99119460-99119482 TTTCTCATGTTGATGCTGTCAGG - Intergenic
912747094 1:112253969-112253991 CCTCAGCTGGTGATGGAGTCAGG - Intergenic
916979803 1:170121767-170121789 ACTCACATGATTATGGAGACTGG - Intergenic
917630060 1:176882853-176882875 ACTCACATGTAAATGGTGTCAGG + Exonic
918787531 1:188782336-188782358 CCTCACATGTTGTTGGACACAGG + Intergenic
918899035 1:190388655-190388677 TGTCTCATGTTTCTGGAGTCTGG - Intronic
918904302 1:190473576-190473598 GCTAACATGTTGAAGGAGCCTGG - Intronic
919102329 1:193109922-193109944 ACTCACATGATTATGGAGGCTGG - Intergenic
920205906 1:204291991-204292013 TTTCACATGGTGATGGAATGAGG + Intronic
920975077 1:210778161-210778183 TCCCACATGTGGTTGCAGTCAGG - Intronic
921864593 1:220074874-220074896 TCTGACATATTGATTGAGTGAGG - Intronic
923378719 1:233393010-233393032 GCTCACATGTTTGTGGAGCCTGG + Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063955221 10:11259212-11259234 CCTCACATGGTGCTGAAGTCAGG - Intronic
1065244645 10:23744757-23744779 GCTCACATGATTATGGAGGCTGG + Intronic
1065590231 10:27256276-27256298 TCTCTCAGGGGGATGGAGTCTGG - Intergenic
1066565182 10:36714849-36714871 TGTCACATGGTGGTGAAGTCTGG - Intergenic
1077058197 11:606150-606172 TCCCACCTGTTGGTGGAGTTGGG + Intronic
1077856227 11:6128925-6128947 TCTTTCATGTGCATGGAGTCAGG + Intergenic
1080903262 11:36515595-36515617 TCCCTCATGTTGATGGAGTACGG - Intronic
1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG + Intergenic
1082753611 11:57049350-57049372 CCTCATATGTTGATAGAGTTTGG - Intergenic
1084118575 11:67056096-67056118 TCGCCCACGTTGAGGGAGTCAGG - Intergenic
1084838209 11:71821857-71821879 TTCCACATGTGGATGGAGTCAGG - Intergenic
1085856440 11:80181414-80181436 TCTCACATGCTGGTGGGGTAAGG + Intergenic
1088828794 11:113517658-113517680 ACTCACATGATCATGGAGTTTGG + Intergenic
1089766865 11:120774388-120774410 GCTCACATGGTTATGGAGACTGG + Intronic
1090427100 11:126615641-126615663 TCCCAGATGATGATGGAGCCAGG + Intronic
1090528950 11:127569153-127569175 GCTCACATGATTATGGAGGCTGG - Intergenic
1092400494 12:8172226-8172248 TTCCACATGTGGATGGAGTCAGG + Intronic
1092655809 12:10684471-10684493 GCTCACATGATTATGGAGGCTGG + Intergenic
1093883230 12:24429490-24429512 TCTCAGATGTGGATGGGGTGGGG + Intergenic
1095132405 12:38559959-38559981 TTTCACATGATTATGGAGGCTGG + Intergenic
1095136731 12:38614211-38614233 TCTCACCTGTTGATATGGTCTGG + Intergenic
1098934435 12:76461784-76461806 TCTCTCATGTGGTTGCAGTCAGG - Intronic
1099084928 12:78233990-78234012 TTTCACATTTTGATTGATTCTGG + Intergenic
1100212054 12:92407820-92407842 TGTCCCAAGTTGATGGAGTTTGG + Intergenic
1100270209 12:93017426-93017448 TCTCACATGCTCTTTGAGTCAGG + Intergenic
1101082759 12:101205995-101206017 TGCCACAAGCTGATGGAGTCAGG - Intronic
1102414396 12:112748003-112748025 ACTCACATTCTGATGGAGACAGG + Intronic
1105627773 13:22129817-22129839 TTTCACATCTTGATGGGGACTGG + Intergenic
1107173407 13:37370843-37370865 GCTCACATGATGATGGGGGCTGG - Intergenic
1107561069 13:41558131-41558153 TCTCTCATGTGGATGGATTAGGG + Intergenic
1114719570 14:24866298-24866320 GCTCACATGATCATGGAGACTGG - Intronic
1115851250 14:37592020-37592042 TCGAACATGTTGCCGGAGTCCGG + Exonic
1116525313 14:45896880-45896902 TCTTACAGGTTGCTGGAGGCTGG - Intergenic
1119564422 14:75616517-75616539 TTTTACATGTTTATGGAGTATGG + Intronic
1120186227 14:81396191-81396213 CCTCACATGATGGTGGCGTCTGG - Intronic
1121584190 14:95051706-95051728 GCTCACATGATTATGGAGACTGG + Intergenic
1121618152 14:95327616-95327638 TCTCTCATGCTGTTGCAGTCAGG - Intergenic
1122695108 14:103548622-103548644 TCACCCATGTTGGGGGAGTCAGG - Intergenic
1124210631 15:27762225-27762247 TCTCACATGGACATGGAGTATGG - Intronic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1128934444 15:71733259-71733281 TCTTCCATGTCAATGGAGTCTGG + Intronic
1131333745 15:91526861-91526883 TCTCACCTGTTTATGTAGGCAGG - Intergenic
1132361921 15:101223386-101223408 TCACACATGTTCATGTGGTCTGG - Intronic
1135610271 16:23860261-23860283 TGTCACCTATTGAGGGAGTCCGG + Intronic
1137746735 16:50826890-50826912 GCTCACATGATTATGGAGGCTGG + Intergenic
1137822074 16:51455618-51455640 TCTAAAATCTTGGTGGAGTCTGG + Intergenic
1140714678 16:77711792-77711814 TATCACATGTGGATTAAGTCCGG - Intergenic
1141164232 16:81649738-81649760 TCTTACATTTGCATGGAGTCTGG - Intronic
1141839910 16:86567783-86567805 TCGAACATGTTGTAGGAGTCCGG - Exonic
1142327079 16:89422485-89422507 TCGCACCTGTTAGTGGAGTCCGG - Intronic
1146335060 17:31962417-31962439 TTTTACATGTTTGTGGAGTCAGG - Intronic
1148747146 17:49924741-49924763 TCTCACAGATTGAGGGAGGCAGG + Intergenic
1149606911 17:57931583-57931605 TCTCACATATGCATGGACTCAGG + Intronic
1151049111 17:70956648-70956670 GCTCACATGATGGTGGAGGCTGG + Intergenic
1156691214 18:39709124-39709146 TCCCACATGTTGAGGGAGAGGGG + Intergenic
1156801835 18:41124434-41124456 TCTCACATCTTGATTTAATCTGG - Intergenic
1157100405 18:44724101-44724123 GCTCACATGTTGGTGGACACAGG + Intronic
1157669644 18:49517526-49517548 GCTCACGTGATGATGGAGGCTGG + Intergenic
1159450705 18:68598518-68598540 GCTCACATGATTATGGAGGCTGG - Intergenic
1159560518 18:69987816-69987838 TCTCACTTGTTCATGGTGTATGG - Intergenic
1164855086 19:31514524-31514546 TCTCTGATGTTTATGAAGTCTGG + Intergenic
1168183305 19:54678655-54678677 TCTTTCTTTTTGATGGAGTCTGG - Intronic
925781518 2:7386416-7386438 TCTCACATGCTGCTAGTGTCTGG - Intergenic
926902846 2:17774806-17774828 TGCAAGATGTTGATGGAGTCAGG + Intronic
929125532 2:38519870-38519892 TCTCAAATGTTGATGGTGTTGGG - Intergenic
930784187 2:55254746-55254768 ACTCACATTTAGATGAAGTCTGG - Exonic
931408134 2:62001141-62001163 TCTCACTTGTGGACAGAGTCTGG + Intronic
933154965 2:78963238-78963260 TCTCACCTGTTAAGGGATTCAGG + Intergenic
934526885 2:95057482-95057504 TCTCAAATGTTGAAGAAGCCCGG - Intergenic
936348729 2:111696380-111696402 CCTCACATGATTATGGAGGCTGG + Intergenic
936751916 2:115653041-115653063 GCACAAATGATGATGGAGTCTGG + Intronic
937185126 2:120033109-120033131 TCTCCAATTTTGATTGAGTCAGG + Intronic
940315802 2:152326426-152326448 GCTCACATGATTATGGAGACTGG + Intergenic
942251906 2:174054243-174054265 TCTCACTTGTTGATCCACTCAGG - Intergenic
947202060 2:227622631-227622653 GCTCCCATGGTGATGGAGGCTGG + Intronic
1169626300 20:7573655-7573677 GCTCACATGATTATGGAGGCTGG + Intergenic
1169740410 20:8887810-8887832 TCTCACAGGTTTTTTGAGTCAGG + Intronic
1169861788 20:10160200-10160222 TTTGACATGTTGATGGAAGCAGG + Intergenic
1172681938 20:36723094-36723116 TCTCTCATGTGGTTGCAGTCAGG - Intronic
1175572610 20:60035676-60035698 TCCCACATGTTGAGGGAGGGAGG + Intergenic
1175683885 20:61012264-61012286 ACTCACATGATTATGGAGGCTGG - Intergenic
1176158682 20:63637222-63637244 TCTCTCATGATGTTGCAGTCAGG - Intergenic
1176953295 21:15071109-15071131 TCTCTCATGTGGCTGCAGTCAGG + Intergenic
1177616765 21:23532719-23532741 TATCACAATTTGATGGAGGCAGG - Intergenic
1178440741 21:32596062-32596084 TCTCACATGTGGGTGGTGTCCGG + Intronic
1181747371 22:24964944-24964966 TCCCACATGTTGATGCTGTGTGG + Intronic
1184777983 22:46632814-46632836 TGGCACATGTGGATGGAGCCGGG + Intronic
949589496 3:5479142-5479164 TCTCACGTGTAAATGGAGTGAGG - Intergenic
950859472 3:16135036-16135058 CCTCTCATGTTGCTGTAGTCAGG + Intergenic
954682099 3:52351373-52351395 TCACAGATGTTGGGGGAGTCAGG + Intronic
956354529 3:68376824-68376846 TCCCACATGTTGAGGGAGGGAGG + Intronic
956963330 3:74429636-74429658 TTTTAAATGTTGATGCAGTCTGG - Intronic
957772393 3:84711172-84711194 TTTGATATGTTGATGGATTCAGG - Intergenic
962055990 3:131872258-131872280 GCTCACATGATTATGGAGACTGG + Intronic
965488597 3:169309134-169309156 TCTTGCATGTTTATAGAGTCCGG - Intronic
965873358 3:173286776-173286798 TCTTTCTTCTTGATGGAGTCTGG - Intergenic
967722635 3:192831384-192831406 TCTCACAGTTTCTTGGAGTCAGG - Intronic
967947253 3:194813786-194813808 TCTCAGGTGTTTAAGGAGTCGGG + Intergenic
968947000 4:3670414-3670436 TCTCACAGGCTGATGGTGCCTGG - Intergenic
969779628 4:9389364-9389386 TTCCACATGTAGATGGAGTCAGG - Intergenic
970805556 4:20026283-20026305 ACTCACATGATAATGGAGACTGG - Intergenic
971734459 4:30428297-30428319 ACTCACATGATGAAGGAGGCTGG - Intergenic
973977492 4:56277255-56277277 TCTTACATGTTGTTGGATTCAGG - Intronic
977586588 4:98781269-98781291 GCTCACATGATAATGGAGGCTGG - Intergenic
980418209 4:132521136-132521158 TCTGTCATGCTTATGGAGTCTGG + Intergenic
983861538 4:172713304-172713326 GCTCACATGATCATGGAGGCTGG + Intronic
984107481 4:175566920-175566942 GCTCACGTGTTTATGGAGGCTGG - Intergenic
984136853 4:175952003-175952025 ACTCACATGATTATGGAGGCTGG - Intronic
984363376 4:178767082-178767104 TCTCACAAGATTATGGAGGCTGG - Intergenic
985224307 4:187743888-187743910 TCTCTCATGTTGCTGAGGTCTGG + Intergenic
986130697 5:4927184-4927206 TTTCACAGGTTGATGGGGTTGGG + Intergenic
986459115 5:7951919-7951941 TCTCACATGGTTCTGGAGGCTGG - Intergenic
987951643 5:24684214-24684236 GCTCACATGATTATGGAGGCTGG - Intergenic
988909678 5:35826726-35826748 CCTCACAGGATGATGGAGTGAGG - Intergenic
989818463 5:45765217-45765239 TCTCTCCTGTGGATGGACTCAGG + Intergenic
990718511 5:58666664-58666686 TCACACATGTGGATGAAGTTAGG + Intronic
996191952 5:120555493-120555515 TCTCACATGGTGGTGGGGTGGGG + Intronic
996508587 5:124294217-124294239 CCTCACATGTTGAGGGAGGGAGG + Intergenic
996903487 5:128571603-128571625 TGTCCCATGTTGAGGGAGTGAGG - Intronic
997035681 5:130188721-130188743 TCTCACATGTGCATGATGTCAGG - Intergenic
997445571 5:133937355-133937377 GCTCACATGATTATGGGGTCCGG + Intergenic
998527100 5:142852602-142852624 TCTCGCATGTTGATGCATTTTGG + Intronic
999858793 5:155623273-155623295 TCTCATAGGTTGCTGGGGTCTGG - Intergenic
1000813144 5:165887548-165887570 GATCACATGATTATGGAGTCTGG - Intergenic
1002119932 5:176995232-176995254 TTTCATCTGTTGATGGAATCTGG - Intronic
1002927076 6:1610911-1610933 TCGAACATGTTGTAGGAGTCCGG - Exonic
1004904686 6:20226293-20226315 GCTCACATGTTTATGGAGGCTGG - Intergenic
1012027603 6:94017253-94017275 TCTCATATGATTATGGAGCCTGG - Intergenic
1014457623 6:121654485-121654507 TGCCACATGATGATGCAGTCAGG + Intergenic
1015470752 6:133603462-133603484 GCTCACATGATTATGGAGGCAGG + Intergenic
1016550294 6:145271958-145271980 ACTCACATGATTATGGAGGCTGG + Intergenic
1018578940 6:165290779-165290801 TCACACAGGTTGATCGGGTCAGG + Intronic
1022220491 7:28309173-28309195 TCTCACATGATAATGGAGGCTGG - Intronic
1023081196 7:36528059-36528081 TATCAGATGTTCATGGAGGCAGG + Intronic
1030787392 7:113679327-113679349 TCTCACATGCTTTTGGACTCTGG + Intergenic
1030789385 7:113705248-113705270 GCTCACATGATTATGGAGGCTGG - Intergenic
1032177998 7:129648690-129648712 CCTTACATGGTGAGGGAGTCAGG - Intronic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1034686930 7:152980440-152980462 TCTGACATGATGGTGGAGACTGG + Intergenic
1035307661 7:157943570-157943592 TCCTCCATGTTGAGGGAGTCTGG - Intronic
1035530209 8:345347-345369 TCCCACAGGTTTATGGGGTCTGG + Intergenic
1036114770 8:5946618-5946640 TCTCACCTGTTGATGTGGTTTGG - Intergenic
1036228969 8:6983559-6983581 TCACACATGTTTATGGTGTCTGG + Intergenic
1036231420 8:7002664-7002686 TCACACATGTTTATGGTGTCTGG + Intronic
1036233878 8:7021760-7021782 TCACACATGTTTATGGTGTCTGG + Intergenic
1036277063 8:7363327-7363349 TTCCACATGTGGATGGAGTCAGG - Intronic
1036344271 8:7947019-7947041 TTCCACATGTGGATGGAGTCAGG + Intronic
1036687632 8:10922536-10922558 ACTCACATGATGATTGATTCTGG - Intronic
1036839612 8:12107791-12107813 TTCCACATGTGGATGGAGTCAGG + Intronic
1036861404 8:12354031-12354053 TTCCACATGTGGATGGAGTCAGG + Intergenic
1037515239 8:19624584-19624606 TCTCATGTGTTAATGGAGTTTGG + Intronic
1037782590 8:21880564-21880586 TCTTTCTTTTTGATGGAGTCTGG - Intergenic
1038998589 8:32954027-32954049 TTTCCCATGTTGCTGCAGTCAGG + Intergenic
1040681052 8:49809746-49809768 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1044538004 8:93379581-93379603 TCTCTCATGTGGCTGGAATCAGG - Intergenic
1045116380 8:98986906-98986928 TTTCACTTGGTGAAGGAGTCAGG + Intergenic
1047271297 8:123361872-123361894 TATCAAATGTTCATGGAGACAGG + Intronic
1047284082 8:123471464-123471486 GCTCACATGATTATGGAGGCTGG + Intergenic
1050260894 9:3839794-3839816 TCCAAAATGTTGATGCAGTCTGG - Intronic
1055798867 9:80009192-80009214 GCTCACATGATTATGGAGCCTGG + Intergenic
1056197781 9:84245354-84245376 GCTCACGTGATGATGGAGGCTGG + Intergenic
1058071897 9:100609899-100609921 GCTCACATGATTATGGAGGCTGG + Intergenic
1185716363 X:2345886-2345908 GCTCATATGGTGATGGAGGCTGG - Intronic
1189945606 X:46174656-46174678 TCTAAAATGTTTATGGATTCAGG + Intergenic
1190107054 X:47568551-47568573 TCTCACAAATTCATGGAATCTGG + Intronic
1190561901 X:51694723-51694745 ACTCACGTGATGATGGAGGCTGG + Intergenic
1191876126 X:65798497-65798519 AGTCACATGTTGTTGGATTCAGG + Intergenic
1193734372 X:85139166-85139188 TCCCAAATGTTGAGGGACTCTGG - Intergenic
1195965826 X:110429282-110429304 TCTCACTTGTTGAATGACTCAGG + Intronic
1196756016 X:119158077-119158099 TCTCCCATCTGGATGGAGACTGG - Intergenic