ID: 911052031

View in Genome Browser
Species Human (GRCh38)
Location 1:93680002-93680024
Sequence CTGGAGAGTCAGATGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911052025_911052031 25 Left 911052025 1:93679954-93679976 CCCCATGACAGAGAATTTACAAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG No data
911052027_911052031 23 Left 911052027 1:93679956-93679978 CCATGACAGAGAATTTACAACTT No data
Right 911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG No data
911052026_911052031 24 Left 911052026 1:93679955-93679977 CCCATGACAGAGAATTTACAACT 0: 1
1: 1
2: 1
3: 27
4: 297
Right 911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911052031 Original CRISPR CTGGAGAGTCAGATGGAGAG AGG Intronic
No off target data available for this crispr