ID: 911053406

View in Genome Browser
Species Human (GRCh38)
Location 1:93691405-93691427
Sequence CCTGTGGGGTACACACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911053406 Original CRISPR CCTGTGGGGTACACACAGCC TGG Intronic
900944066 1:5819806-5819828 CATGTGGGGCAGACACAGCCTGG - Intergenic
901739735 1:11334420-11334442 CCTGTAGGGTCCACCCAGCCGGG - Intergenic
901754821 1:11435099-11435121 CCTGTGGGAGACACGGAGCCTGG - Intergenic
903066175 1:20700944-20700966 CCTGTGGGAAACACACAGCAAGG - Intronic
909995289 1:82271535-82271557 CCTGTTGGGTACTCACTACCTGG + Intergenic
910669803 1:89761794-89761816 CCTGTGGGGGCCCCACAGACAGG + Intronic
911053406 1:93691405-93691427 CCTGTGGGGTACACACAGCCTGG + Intronic
911303389 1:96203943-96203965 CCTGTGATGTACACACACACAGG - Intergenic
912456780 1:109803398-109803420 CCTGTGGGGCAGCCACAGCCTGG + Intergenic
913333060 1:117683249-117683271 TCTGTGAGGTCCACACAGCCAGG + Intergenic
916322658 1:163522244-163522266 CCTGTGGGGGAAACAGAGCATGG + Intergenic
916955390 1:169827799-169827821 CCTGTGGTGCACAGACAGCCAGG + Exonic
920334774 1:205237682-205237704 CCTTTGGGGGACCCACACCCAGG + Intronic
920376589 1:205512080-205512102 CCCTTGGGGGACACACAGGCAGG + Intronic
920430026 1:205912813-205912835 GCTGAGGGGTCCACACACCCAGG - Intergenic
920651220 1:207838787-207838809 CCTGTTGGGAACACACAGCTGGG - Intergenic
1063389472 10:5640037-5640059 CTTGTGGGGAATACAAAGCCAGG + Exonic
1063999901 10:11654886-11654908 CTTGTGTGGTACACACAGACAGG + Intergenic
1065730480 10:28705560-28705582 CCTGAGTGGGCCACACAGCCAGG - Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1067546287 10:47194747-47194769 GCTGTGGGGCAGACACAGCTGGG + Intergenic
1068213501 10:53952706-53952728 CCTCTTGGGCACAAACAGCCTGG - Intronic
1070830856 10:79417354-79417376 CCTGTGGCTCCCACACAGCCAGG + Intronic
1070934282 10:80281337-80281359 CCTGAGAGGTACACAGAGTCTGG + Intronic
1071938116 10:90553204-90553226 CCTGTGGGGTACAAATAGACTGG - Intergenic
1073508845 10:104029371-104029393 GCTGTGGACTACACACAGCTAGG - Intergenic
1075384058 10:122041796-122041818 GCTGTGGGGTTCCCCCAGCCCGG + Intronic
1075948471 10:126457672-126457694 GCTGAGGGGCCCACACAGCCTGG + Intronic
1075977789 10:126711164-126711186 GCTGTAGGTTACACAGAGCCAGG + Intergenic
1076289923 10:129337520-129337542 CCTGTGGGGTTGACCCATCCAGG - Intergenic
1076322640 10:129594859-129594881 CCTGCGAGTTACACACATCCAGG + Intronic
1076828521 10:132982697-132982719 CCTGTGAGCTCGACACAGCCAGG + Intergenic
1077160245 11:1109429-1109451 CCGGCAGAGTACACACAGCCAGG - Intergenic
1077546227 11:3171233-3171255 CCTGAGGGGCACACGCACCCAGG - Intergenic
1078352657 11:10607447-10607469 TCTGTGGCGTTCCCACAGCCAGG + Intronic
1079656145 11:22988370-22988392 TCTGTGGGCTGCACACAGCAGGG + Intergenic
1081968511 11:47183639-47183661 TCCGTGGGGAACACACAACCCGG + Intronic
1083173429 11:60935842-60935864 CCTGTGGGGCACACAGACACAGG - Exonic
1089619922 11:119716253-119716275 GTTCTGGGGCACACACAGCCAGG + Intronic
1090324647 11:125874410-125874432 CCTGTTGCGGACACCCAGCCGGG - Intergenic
1091016338 11:132054303-132054325 CCTGTGGAGTCCACACAGCTTGG - Intronic
1091808526 12:3375770-3375792 CATCTGGGGAACACAAAGCCTGG - Intergenic
1100089619 12:90954330-90954352 CCTGGGGGCTTCACCCAGCCAGG + Exonic
1101514730 12:105424155-105424177 CCTGTGGTGGAAACACATCCAGG - Intergenic
1102680113 12:114685364-114685386 CCTGTGCTGTGCACCCAGCCGGG - Intergenic
1102697032 12:114808022-114808044 CCTGTGGAGGAAACACAGCCTGG + Intergenic
1103482773 12:121261604-121261626 CCTGTGGGGAAGGCACACCCAGG + Intronic
1103852668 12:123943493-123943515 CCTGTGGGTAACACAGACCCTGG + Exonic
1104771804 12:131368575-131368597 CCTGTCGGGCACACAGGGCCTGG + Intergenic
1104823565 12:131693048-131693070 TCTGTGGTGTAAACACTGCCCGG - Intergenic
1112813693 13:103248952-103248974 CCTCTGGGGTTCCCACAGGCAGG + Intergenic
1117954566 14:61112670-61112692 CCCGTGGAGAACACACATCCTGG - Intergenic
1118299623 14:64603565-64603587 CTTGTGGGGTAGAAAAAGCCAGG - Intergenic
1119163673 14:72474625-72474647 TCTGTTGTGTTCACACAGCCTGG - Exonic
1119670433 14:76514233-76514255 CCTCTGGGGTACACACAAGAGGG + Intergenic
1119687754 14:76646047-76646069 CCTGTGATGCACACACACCCGGG + Intergenic
1121313315 14:92946705-92946727 CCTGTGGGCTCATCACAGCCTGG + Intronic
1121338079 14:93089271-93089293 GCTGTGGGGTAGACACGCCCTGG + Intronic
1121531138 14:94654314-94654336 CATGTGGGGCACAGGCAGCCTGG + Intergenic
1122046226 14:99025936-99025958 CCTGTGTGGTAGGCACAGCCTGG - Intergenic
1122401399 14:101469582-101469604 GCTGTGGGGGAAGCACAGCCTGG - Intergenic
1123893868 15:24809174-24809196 CCTCTGGGCTCCACACAGGCTGG - Intergenic
1125827488 15:42688777-42688799 CCTCTGAGGCACACACTGCCTGG + Exonic
1128110176 15:65071360-65071382 TCTGTGGGCTGCCCACAGCCAGG + Intronic
1128382226 15:67121398-67121420 CATGTGGGGCACACCCTGCCAGG - Intronic
1128570268 15:68728590-68728612 CCTGTGGTGTACACACTGCCGGG - Intergenic
1128707113 15:69844348-69844370 CCTCTGGGGTGCACACACTCAGG + Intergenic
1130994571 15:88896727-88896749 TGTGTGTGTTACACACAGCCAGG + Intergenic
1131228249 15:90642641-90642663 GCCGTGGGGTCCACTCAGCCTGG - Exonic
1131447141 15:92509865-92509887 CCTGTGGGGTTTTCACAGACTGG - Intergenic
1132240891 15:100256390-100256412 CCTGTGCGTAACTCACAGCCAGG + Intronic
1132244723 15:100285756-100285778 CCTCTGGGCTCCACACAGGCTGG - Intronic
1132246264 15:100298536-100298558 CGTGTTGGGCACACACATCCAGG + Intronic
1132666761 16:1084535-1084557 CCTGTGGAGCAGAGACAGCCAGG + Intergenic
1132997008 16:2828729-2828751 CATGTGGGGTCCACACACACTGG + Intergenic
1133660242 16:7909503-7909525 ACTGTTGGATCCACACAGCCTGG - Intergenic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1135086570 16:19479343-19479365 CCTGATGGGTACATAGAGCCAGG + Intronic
1137223802 16:46482422-46482444 CTGGTGTGGTACCCACAGCCTGG - Intergenic
1138680523 16:58680665-58680687 CCTGTGGGGTGGAAACAGGCTGG - Intronic
1139660014 16:68414419-68414441 CCTGTGGGGTAGGCTCAGCCTGG + Intronic
1141422232 16:83924794-83924816 CCTAGGGGGTACATCCAGCCAGG + Exonic
1142976208 17:3646104-3646126 CTTCAGGGTTACACACAGCCTGG - Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1147457874 17:40549795-40549817 CCCGTGGGGAATACACATCCTGG + Intergenic
1147765527 17:42833294-42833316 CCAGCGGGGTTCACACTGCCGGG - Intronic
1148795624 17:50195330-50195352 CCTGTGGGAGGCAGACAGCCAGG + Exonic
1150589320 17:66548488-66548510 CCTGTGTGGTACACACAGCTTGG - Intronic
1152078085 17:78170757-78170779 CCTGAGGGGCACACACAGCGGGG - Intronic
1152207219 17:78980683-78980705 CCTCTGGGAACCACACAGCCGGG - Intergenic
1152697013 17:81802648-81802670 CCTGTGGGGGTCACAGAGCTGGG + Intergenic
1154339129 18:13488716-13488738 CACGTGGGGCACACACACCCAGG + Intronic
1156369098 18:36456639-36456661 CCCGTGGGGGACACACAGGCTGG - Intronic
1156856775 18:41791417-41791439 CCTGAGGGATACTCACAGCCAGG + Intergenic
1161029276 19:2050499-2050521 CTTGCAGGGGACACACAGCCTGG + Intronic
1161091126 19:2360500-2360522 CCGGTGGTGTCTACACAGCCTGG - Intergenic
1161314509 19:3611563-3611585 CCTGTGGGCCCCACCCAGCCTGG + Exonic
1161683925 19:5693949-5693971 CCTGTGGGGCGTACAGAGCCAGG - Intronic
1163208096 19:15818983-15819005 CCTGTGGAGTACACAGTGGCAGG + Intergenic
1163440813 19:17321822-17321844 ACTGTGGTGTAGACACTGCCGGG - Exonic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1164294423 19:23897163-23897185 CCTGTGGGCAACACCAAGCCTGG - Intergenic
1164495196 19:28754289-28754311 CCTTTGGGCTACACAAAGGCTGG - Intergenic
1164680758 19:30132301-30132323 TCAGGGGGGGACACACAGCCAGG - Intergenic
1165075680 19:33278800-33278822 CCTGGGGAGGCCACACAGCCAGG + Intergenic
1165827447 19:38713426-38713448 CCAGTGTGGAAAACACAGCCAGG - Intronic
1166108511 19:40609508-40609530 CCTGGGGGGTCCAGTCAGCCAGG - Exonic
1166542144 19:43612460-43612482 GCGGAGGGGCACACACAGCCGGG + Exonic
1202712890 1_KI270714v1_random:27265-27287 CGGGAGGGGCACACACAGCCGGG + Intergenic
1202712901 1_KI270714v1_random:27303-27325 CGGGAGGGGCACACACAGCCGGG + Intergenic
928680734 2:33699925-33699947 CCTCTGGGCTCCACGCAGCCTGG - Intergenic
929950217 2:46404358-46404380 CCTGGGAGGTAAACACACCCAGG + Intergenic
931188478 2:59976627-59976649 CCTGTGGGGAAGACACACACAGG + Intergenic
931435296 2:62240684-62240706 GCTTTAGGGTCCACACAGCCTGG + Intergenic
933835115 2:86239851-86239873 CATGTGGGGCACACGGAGCCAGG - Intronic
934120456 2:88832843-88832865 ACTGTGAGGGACACGCAGCCTGG - Intergenic
937346614 2:121130009-121130031 CCTGTGGGGTACACTCACATGGG + Intergenic
938115850 2:128602611-128602633 CCTGTGGTGTGTACAGAGCCAGG - Intergenic
940436813 2:153665869-153665891 CCTCTGGGCTCCACACTGCCTGG - Intergenic
942619793 2:177834552-177834574 CCTGTCTGGGGCACACAGCCTGG + Intronic
948189065 2:236044496-236044518 CCTGTGAGGTCCACGCAGCAGGG - Intronic
948403724 2:237702417-237702439 CCTGTTCAGAACACACAGCCTGG - Intronic
948571038 2:238917170-238917192 AGTGTGGGGTGCTCACAGCCAGG + Intergenic
948887952 2:240893255-240893277 GCTGAGGGGTCCACACAGCCAGG - Intronic
1169012204 20:2260090-2260112 CCTGTGGGTAACACACACCTTGG - Intergenic
1169740970 20:8893782-8893804 CTTGTGGGGTAGACACAACCAGG + Intronic
1172017399 20:31885927-31885949 CCTGTGGGGGCCACACTGCAGGG + Intronic
1172128966 20:32643148-32643170 CCTGTGTGGTAAAGACAGGCTGG + Intergenic
1172168140 20:32911458-32911480 CCTGTAGGGAGCACACAGCTGGG - Intronic
1172487431 20:35306807-35306829 CCTGAGGGATCCACAGAGCCAGG + Intronic
1172975255 20:38901267-38901289 TCTGTGGGGTACACAAGGGCAGG - Intronic
1173569521 20:44067432-44067454 CCAGTGGGCTACACTCACCCCGG - Intronic
1174102535 20:48138416-48138438 CCTGTGGGGTAAACATGGCCTGG + Intergenic
1175270280 20:57729054-57729076 CCTGTGGGCCACATCCAGCCTGG + Intergenic
1175781629 20:61685865-61685887 CCAGTGGGGATCCCACAGCCCGG - Intronic
1176068790 20:63215621-63215643 GACGTGGGGTACACACAACCCGG + Intronic
1176223462 20:63980899-63980921 CCTGGGGGCTAAAAACAGCCTGG - Intronic
1178849385 21:36200519-36200541 GCAGTGGAGTAAACACAGCCTGG - Intronic
1179439034 21:41380438-41380460 CCTGTGGAGTAGAGAAAGCCTGG - Intronic
1180205583 21:46257443-46257465 CCTTGCTGGTACACACAGCCTGG - Intronic
1180737925 22:18032430-18032452 TCTGTGGTTTCCACACAGCCAGG + Intergenic
1180738279 22:18034966-18034988 TCTGTGGGGTGCTCCCAGCCTGG + Intergenic
1180959055 22:19754516-19754538 CCTGGGAGTTAGACACAGCCTGG - Intergenic
1182218368 22:28738320-28738342 GCTGTGGGGAAGACTCAGCCTGG - Intronic
1183238250 22:36636425-36636447 TCTGTGGCATACACACAACCTGG + Intronic
1184383673 22:44162036-44162058 TCAGTGGGGAAGACACAGCCCGG - Intronic
949949351 3:9216427-9216449 CCTGTGGAGCAGCCACAGCCCGG + Intronic
950020038 3:9780549-9780571 CCTGTGGGGACCAGCCAGCCAGG + Exonic
950402177 3:12777592-12777614 TCTGGGGCATACACACAGCCTGG - Intergenic
955333381 3:58065735-58065757 CCTGTGGGGTGCACAGCCCCAGG + Intronic
956725208 3:72151301-72151323 CCTCTGGGATGCACACAGCAAGG - Intergenic
958064794 3:88529176-88529198 CCTCTGGGCTCCACACAGGCTGG + Intergenic
959580909 3:107981643-107981665 CCTCTGTTGTACACAAAGCCAGG + Intergenic
960015715 3:112885462-112885484 CCTCTGGGCTTCACACAGGCTGG + Intergenic
960575262 3:119222875-119222897 CCTGCAGCTTACACACAGCCGGG + Intronic
961839568 3:129697389-129697411 CCTGTGGGCTGTACACAGCAGGG + Intronic
962938153 3:140100657-140100679 CGTGTGGCCCACACACAGCCTGG - Intronic
963003960 3:140708524-140708546 CCAGTGGGGAACACACATTCAGG + Intergenic
963780264 3:149479723-149479745 CCTGTGAGGCAGACACAGACTGG + Intronic
965147820 3:164928550-164928572 CCTCTGGGGTCCACACAGACTGG + Intergenic
967103944 3:186240353-186240375 CATGTAGGGGACTCACAGCCTGG - Intronic
968734001 4:2285855-2285877 CCTGTGGGGACCACAGACCCCGG - Intronic
968877444 4:3280435-3280457 GCTGTGGCTCACACACAGCCAGG - Intergenic
969452342 4:7281782-7281804 CCTGTGTGCTAATCACAGCCGGG + Intronic
969836989 4:9850311-9850333 CCTCTGGGCAACACACAGGCTGG - Intronic
980791886 4:137631622-137631644 CCTCTGGGCTTCACACAGGCTGG - Intergenic
981466229 4:145075797-145075819 CCTCTGGGCTCCACACAGGCTGG - Intronic
982091737 4:151885536-151885558 CCTGTGGGCTTCACAGAGACAGG - Intergenic
982248165 4:153376536-153376558 ACTGTGATGTGCACACAGCCAGG + Intronic
985531217 5:434729-434751 CCAGTGGGCTACTCACAGCCAGG + Exonic
986015118 5:3750906-3750928 CAAATGGGGCACACACAGCCGGG + Intergenic
986288228 5:6377050-6377072 GCTGTGTGGTAGGCACAGCCTGG - Intronic
989209480 5:38845623-38845645 CCTGTGGGATACACAGCCCCAGG + Intergenic
990594612 5:57300402-57300424 CCTTTGGCATAGACACAGCCAGG - Intergenic
992188276 5:74265131-74265153 CTTGTGGGGTAAACACAAACGGG + Intergenic
993228836 5:85204959-85204981 CCTCTGGGCTCCACACAGGCTGG + Intergenic
994046442 5:95315955-95315977 ACTGTTGGGTACACTCTGCCTGG + Intergenic
995556850 5:113338380-113338402 CCCTTGGGGTTCCCACAGCCAGG - Intronic
998930722 5:147178272-147178294 CATGTGGGATACACACACACAGG - Intergenic
999536954 5:152528370-152528392 CCTGTGGGGAACATACAGGCAGG + Intergenic
999734025 5:154499170-154499192 CCTGTGGGTTTCTCACAGCTGGG - Intergenic
1001132843 5:169079232-169079254 TCTGTGGGTTACACACCACCTGG - Intronic
1001515386 5:172351895-172351917 CGTGTGGGTTATATACAGCCTGG - Intronic
1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG + Intergenic
1006669254 6:35719606-35719628 CCTGTGTAGTCCACAGAGCCTGG + Intronic
1006915621 6:37591999-37592021 CTGGTGGGGCACACACAGCTGGG + Intergenic
1011713969 6:90085080-90085102 CCTGTGAGGAACACACAGGATGG - Intronic
1016577401 6:145584537-145584559 CCTCTGGGCTCCACACAGGCTGG + Intronic
1017957081 6:159187567-159187589 GCTGTTGGGTAGACACAGTCTGG - Intronic
1018678728 6:166245408-166245430 CCTGTGTGATACACTGAGCCCGG - Intergenic
1018957042 6:168417157-168417179 CCCGTGGCGCACACTCAGCCAGG - Intergenic
1019417907 7:935634-935656 CCTGTGGGGCGCACGGAGCCTGG - Intronic
1019505021 7:1386388-1386410 CCTGTGGGGAGCAGACAGTCGGG - Intergenic
1019539784 7:1546451-1546473 CCGGCGGGGTCCACACAGGCTGG - Exonic
1023531753 7:41164171-41164193 CCTGCGGGCTTCACACATCCTGG - Intergenic
1023818976 7:43969861-43969883 CCTGTGGGGTCAGCTCAGCCAGG + Intergenic
1024647646 7:51383304-51383326 ACAAGGGGGTACACACAGCCTGG + Intergenic
1029346804 7:99984446-99984468 CCTATGGCTAACACACAGCCTGG - Intergenic
1029664348 7:101985321-101985343 CCTGTGGGGGAGACACAGACAGG + Intronic
1029744027 7:102506824-102506846 CCTGTGGGGTCAGCTCAGCCAGG + Exonic
1029762017 7:102605987-102606009 CCTGTGGGGTCAGCTCAGCCAGG + Exonic
1031528930 7:122853317-122853339 CCTGTGGGGTACACCCTCCATGG + Intronic
1031643062 7:124189664-124189686 CCTGTGGGGTACAAAAGGCCAGG - Intergenic
1032086518 7:128886737-128886759 CCTGTGGGGGACACACCTCCTGG + Exonic
1032310346 7:130780398-130780420 CCTCTGGGCTCCACACAGGCTGG + Intergenic
1033355141 7:140593271-140593293 CCTTTGGGGAGCCCACAGCCTGG + Intronic
1033947577 7:146740823-146740845 CCTGAGGGCTACCCAAAGCCTGG + Intronic
1035607771 8:940321-940343 CCTGTGAGGTTGACAGAGCCAGG + Intergenic
1035649340 8:1253227-1253249 CCTGCGTGGTGGACACAGCCCGG - Intergenic
1037177260 8:15961986-15962008 CCTGTGGGCTCCACACAGGCTGG + Intergenic
1038536707 8:28358861-28358883 GCTGTGGTGTCCAAACAGCCAGG - Intronic
1040018438 8:42719327-42719349 TCTGTGGTGAACACACATCCTGG + Intronic
1045478766 8:102576064-102576086 CCCGTGGGGTACCCATAGCTGGG + Intergenic
1046096662 8:109570736-109570758 CCTATGGTGTACAAACAGGCAGG - Intergenic
1047868750 8:129059110-129059132 CCTGTAAGGTCCAAACAGCCAGG + Intergenic
1048000557 8:130376260-130376282 CCTGCTGGGTCCACACAGCCAGG + Intronic
1048967546 8:139625364-139625386 CCTGCTGGGTAGTCACAGCCTGG + Intronic
1049394658 8:142394288-142394310 GCTGTGGGGTGCCCACACCCTGG - Intronic
1049782953 8:144437123-144437145 GCTGTGAGGTACACAGGGCCAGG - Intronic
1051257833 9:15233064-15233086 CCTGTTGCGGACACCCAGCCGGG + Intronic
1053140708 9:35680947-35680969 CCTGTTGTGTACACACAGAAGGG + Exonic
1057017233 9:91663249-91663271 TGTGTGGGGGACACACAGGCTGG + Intronic
1057282019 9:93720127-93720149 CCTATGGTGGACTCACAGCCAGG - Intergenic
1057552593 9:96063121-96063143 CTAGTGGGGTAAACACAGACAGG - Intergenic
1057629609 9:96708650-96708672 TTTGAGGGGCACACACAGCCAGG - Intergenic
1058919215 9:109597285-109597307 CCTGAGGGGTACAAACAGGCTGG + Intergenic
1062355238 9:136158768-136158790 CCTGTGGGAGAAGCACAGCCAGG + Intergenic
1062546500 9:137065978-137066000 CCTGTGGTGAGCACACAGCTGGG + Intronic
1185650112 X:1641633-1641655 CCTGTGAGGTCCACCCATCCTGG + Intronic
1185650128 X:1641716-1641738 CCTGTGAGGTCCACCCATCCTGG + Intronic
1186030275 X:5361176-5361198 CCTATGGGGCACACACAGATGGG - Intergenic
1186540803 X:10398020-10398042 CCTGTGGAGTAAACTCACCCTGG + Intergenic
1187396686 X:18925323-18925345 CCTCTGTGTAACACACAGCCAGG - Intronic
1187801365 X:23067432-23067454 CCTCTGGGCTCCACACAGGCTGG - Intergenic
1189182650 X:39018327-39018349 CCTGGGGGGGGCACACAACCAGG - Intergenic
1189262954 X:39690826-39690848 CTTGTTGGGTATACACACCCAGG + Intergenic
1189678241 X:43486541-43486563 CCTCTGGGCTCCACACAGGCTGG - Intergenic
1189891861 X:45610922-45610944 CCTCTGGGCTCCACACAGGCTGG + Intergenic
1190127998 X:47723050-47723072 CAGGTGGGATACACACAGCCGGG - Intergenic
1190556453 X:51640719-51640741 CCTGTGGGCCAGATACAGCCTGG - Intergenic
1190882671 X:54503924-54503946 CCTGTGGGAAAAACTCAGCCTGG - Intergenic
1191922305 X:66270184-66270206 CCTGCGGGCAACACAGAGCCAGG + Intergenic
1195921608 X:109989527-109989549 CCTGTGAGGGATACACAGCATGG - Intergenic
1196574512 X:117302470-117302492 CCTCTGGGCTTCACACAGACTGG + Intergenic
1196586867 X:117440080-117440102 CCTCTGGGCTCCACACAGGCTGG - Intergenic