ID: 911056277

View in Genome Browser
Species Human (GRCh38)
Location 1:93711025-93711047
Sequence GAGAACACCCAGTCAGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911056277_911056280 -7 Left 911056277 1:93711025-93711047 CCATGGGCTGACTGGGTGTTCTC 0: 1
1: 0
2: 2
3: 20
4: 186
Right 911056280 1:93711041-93711063 TGTTCTCAGGATGTGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911056277 Original CRISPR GAGAACACCCAGTCAGCCCA TGG (reversed) Intronic
900654817 1:3751274-3751296 GAGAAAGAACAGTCAGCCCAGGG - Intergenic
901376990 1:8846597-8846619 AAGGACACCCAGGCAGGCCAGGG + Intergenic
902180795 1:14686922-14686944 GAAGAAACCCAGCCAGCCCAGGG - Intronic
902718012 1:18285931-18285953 GTGAACACACAGAGAGCCCAGGG - Intronic
903220266 1:21865407-21865429 GAGGACACCCTGGCACCCCAGGG - Intronic
906709753 1:47920465-47920487 GAAAACACCCAGCCTCCCCAGGG - Intronic
906838116 1:49106117-49106139 GAGAACAACCAGCCAGCACTGGG - Intronic
907196565 1:52691993-52692015 GAGGACACTCAAGCAGCCCATGG + Intronic
908775901 1:67639669-67639691 GGGAAGACCCAGCCAGCCCCCGG + Intergenic
910116277 1:83735819-83735841 GAGGACACCCAGGCAGCCTAAGG - Intergenic
910435983 1:87206737-87206759 AAGAACACCCACACAGCCCAAGG - Intergenic
911056277 1:93711025-93711047 GAGAACACCCAGTCAGCCCATGG - Intronic
915075584 1:153306122-153306144 GGGAAGACCCAGCCATCCCAGGG + Intronic
916065065 1:161129938-161129960 GAGAAGTCCAAGTCAGCCAAGGG + Intronic
916165650 1:161964990-161965012 AAGAGCTCACAGTCAGCCCATGG + Intergenic
918497829 1:185159040-185159062 GAGGACACTCAAACAGCCCATGG - Intronic
919732369 1:200921486-200921508 GAGAACACCCCCTCCACCCAAGG - Intergenic
920376646 1:205512345-205512367 GAGGAGACCCAGGCAGCCAAAGG + Intronic
920811639 1:209291450-209291472 TAGAACATCCAGGCAGCCCCAGG + Intergenic
920976070 1:210786568-210786590 GAGAACACCCAGGGAGACGAGGG - Intronic
921232176 1:213083962-213083984 GAGAACACTCAGGCAGCCTGTGG + Intronic
923087046 1:230709915-230709937 GAGATCAGCCAGTCAGGCCTTGG - Intronic
923728873 1:236531739-236531761 GAGAAGAATCAGTCAGGCCAGGG - Intronic
1066065333 10:31757477-31757499 GTGAATACCCAGGCAGGCCAAGG - Intergenic
1067483138 10:46619032-46619054 GAGAACATTCAGGCAGCCCGTGG + Intergenic
1067611615 10:47722612-47722634 GAGAACATTCAGGCAGCCCGTGG - Intergenic
1070639885 10:78160618-78160640 GGGATCACAGAGTCAGCCCATGG + Intergenic
1071627035 10:87182853-87182875 GAGAACATTCAGGCAGCCCGTGG - Intronic
1072155870 10:92723138-92723160 TAGGACACCGTGTCAGCCCAAGG - Intergenic
1072608129 10:97000505-97000527 CAGAGCTGCCAGTCAGCCCAGGG + Exonic
1073449945 10:103603308-103603330 GAGGACACCCTGTCAGCCAGAGG - Exonic
1075978767 10:126719489-126719511 GAGCACACCCTCTGAGCCCAAGG + Intergenic
1076905370 10:133358311-133358333 GGCAACACCCAGCCAGCCCACGG + Intergenic
1079544691 11:21618977-21618999 GAGAACATTCAGACAGCCCATGG + Intergenic
1080403082 11:31955150-31955172 GAGAACACCCAGTTAGCAAGAGG + Intronic
1080566397 11:33513464-33513486 GAGAACAACCATTCAGTCCAGGG + Intergenic
1083860408 11:65417346-65417368 GAGGGCACTCAGTCAGACCAAGG + Intergenic
1084336165 11:68459353-68459375 CAGGACACCGAGACAGCCCACGG - Intergenic
1084655893 11:70518157-70518179 GAGAGCACCCACCCAGCCCCTGG + Intronic
1086364196 11:86091704-86091726 GAGAACACTCAAACAGTCCAAGG + Intergenic
1089010313 11:115126973-115126995 GCGAAAACCCAGGCTGCCCAAGG + Intergenic
1089285857 11:117407838-117407860 AAGATCACCCAGTCAGCAAATGG + Intronic
1090880293 11:130826801-130826823 GAAAAGACCCAGGCAGCCAACGG + Intergenic
1091219987 11:133924918-133924940 GACAATACCCAGTCAGCCGAGGG + Intronic
1091683836 12:2547376-2547398 GAGCACACGCAGTCAGCCACGGG - Intronic
1091752571 12:3032055-3032077 GAGAACGCCCAAGAAGCCCAAGG - Intronic
1091919479 12:4292854-4292876 GAGGACCCCGATTCAGCCCAAGG - Intronic
1097363150 12:58680234-58680256 GAGAACACCCTGTCAGTACCGGG - Intronic
1097473269 12:60021835-60021857 GAAAAGACCCAGTCCTCCCAGGG - Intergenic
1097651648 12:62305968-62305990 GAGGACACTCAGGCAGCCTATGG + Intronic
1098520439 12:71430067-71430089 GAGAAGACCCTCTCATCCCAGGG + Intronic
1098818876 12:75206198-75206220 GAGAATTCCCATTCTGCCCATGG + Intronic
1102414611 12:112749855-112749877 GAGAACTCTAATTCAGCCCATGG - Intronic
1103001232 12:117386741-117386763 CAGAACACCCAGTGTGCCCCAGG + Intronic
1105407672 13:20145456-20145478 GAAACCACCCAGTCACCCCCAGG + Intronic
1105496906 13:20938458-20938480 GAGGACAACTAATCAGCCCAAGG - Intergenic
1107481978 13:40792717-40792739 AAGAGCACCCAGGCAGCCAAGGG - Intronic
1108199377 13:48027660-48027682 AAGCACATCCAGTCAGCACAGGG + Intergenic
1111959879 13:94798529-94798551 GAGAAGACCCACTCAGCACTTGG + Intergenic
1116941857 14:50798462-50798484 TAGACCATCCAGTCAGCCCTGGG - Intronic
1118595266 14:67430418-67430440 GAGAGCACCCAGGCATTCCAGGG - Intergenic
1118638083 14:67766468-67766490 GAGAACACACGGTGAGTCCAGGG + Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122763085 14:104044210-104044232 GAAAACACACAGTCAGACCCTGG - Intronic
1123458331 15:20445299-20445321 GAGAAAAGCCAGACAGACCATGG + Intergenic
1123659735 15:22555110-22555132 GAGAAAAGCCAGACAGACCATGG - Intergenic
1124264622 15:28221468-28221490 GAGAAAAGCCAGACAGACCATGG + Intronic
1124313596 15:28649605-28649627 GAGAAAAGCCAGACAGACCATGG - Intergenic
1128293229 15:66495627-66495649 CAGAACACCTGTTCAGCCCAGGG - Intronic
1128664148 15:69526117-69526139 GAGGACACCCAAACAGCCTACGG + Intergenic
1131969606 15:97878201-97878223 GGTAACACCCAGTCAGGCCCAGG + Intergenic
1132358517 15:101192366-101192388 GAGAACACACACTCTGCACAGGG + Intronic
1132896728 16:2232728-2232750 GAGAGAACCTAGTCAGCCCCGGG - Intronic
1133203694 16:4220115-4220137 CAGAACACCCAGCCACCCTAAGG + Intronic
1134369912 16:13613635-13613657 CAGAAGACCCAGAAAGCCCATGG + Intergenic
1137696007 16:50462626-50462648 CAGAACACCCAGTCACCATAGGG - Intergenic
1139570025 16:67806123-67806145 GAGAACAGGCAGTCAGCCCTCGG + Intronic
1139703592 16:68725131-68725153 GAGGACACCCAGTCAGCCACAGG + Intergenic
1141035497 16:80622188-80622210 CAGAGCACGCAGCCAGCCCAGGG + Intronic
1141094999 16:81156913-81156935 GACCACACACAGGCAGCCCACGG + Intergenic
1141770759 16:86088450-86088472 GGGAACTCCCAGTCAGGCCATGG + Intergenic
1141949398 16:87330958-87330980 GAAAACCACCAGCCAGCCCAGGG + Exonic
1142088554 16:88197826-88197848 GAGGACACACAGGCAGCCCATGG - Intergenic
1142192581 16:88724820-88724842 GAGAGGACATAGTCAGCCCAGGG + Intronic
1144677539 17:17171540-17171562 GAGAATCCCCAGACAGCCCCAGG + Intronic
1146236243 17:31166459-31166481 TAGAACACTCCCTCAGCCCAAGG - Intronic
1149868071 17:60161622-60161644 GACCACCCCCAGTCAGCCCAGGG + Intronic
1150865026 17:68840502-68840524 GAGAAAAGCCAGTGAGCCTAAGG + Intergenic
1152034423 17:77863457-77863479 GGAAAAACCCAGTGAGCCCAGGG - Intergenic
1152182893 17:78835668-78835690 GAGTAAACCCAGCCATCCCACGG + Intronic
1153524201 18:5979329-5979351 GTGGACACACAGCCAGCCCAGGG + Intronic
1155566201 18:27137474-27137496 GAGCACATCCAGTCAGCAAAGGG + Intronic
1157212561 18:45756301-45756323 GAGCACACACAGGCAGGCCATGG + Intergenic
1159887733 18:73924976-73924998 GAGAACACCCAGCCAGCTGGAGG - Intergenic
1161055148 19:2187219-2187241 GACAACACCCACTCATCCGAGGG - Intronic
1164380591 19:27734240-27734262 GAGAGACCCCAGTCAGCCCCAGG - Intergenic
1165313923 19:35043469-35043491 GAGAACACGCCGTCTGCCCAGGG - Intronic
1166441646 19:42820771-42820793 GAGAACCCTCAGTCACCACAAGG + Intronic
926819102 2:16833407-16833429 GAAGAGACCCAGTCAGACCAGGG - Intergenic
927905852 2:26855716-26855738 GAGAATTTCGAGTCAGCCCATGG - Intronic
929478977 2:42283562-42283584 GAAAACATCCAGTCAGTCCTTGG - Intronic
929724236 2:44407453-44407475 GAGAAAACCCACTCATGCCAAGG - Intronic
929932406 2:46269135-46269157 GAGAACCCCCAGCCAACCTATGG - Intergenic
932456536 2:71852991-71853013 GAGAGCTCCCAGTCAGACCCAGG + Intergenic
932577183 2:72969170-72969192 GGGAACACTCAGGCAGCCCCAGG + Intronic
933729403 2:85445853-85445875 GAGATCACCCAGCCTGCCCAAGG - Intergenic
934145842 2:89093297-89093319 GAGAGAACTAAGTCAGCCCAGGG + Intergenic
934223418 2:90107271-90107293 GAGAGAACTAAGTCAGCCCAGGG - Intergenic
937746491 2:125421736-125421758 GAGTACACCCTGTCAGTCAAGGG + Intergenic
938235436 2:129702269-129702291 GAGAAACCACAGTGAGCCCAGGG - Intergenic
938286368 2:130120775-130120797 GAAAACACCCAGCCCACCCAAGG + Intronic
938337000 2:130509469-130509491 GAAAACACCCAGCCCACCCAAGG + Exonic
938352839 2:130611275-130611297 GAAAACACCCAGCCCACCCAAGG - Intergenic
938429233 2:131218105-131218127 GAAAACACCCAGCCCACCCAAGG - Exonic
943312743 2:186347020-186347042 GAGAACACCCAGACAGGCCCAGG - Intergenic
945047505 2:205794874-205794896 GAGGACGCCCAGTGAGCTCATGG - Exonic
948271404 2:236676569-236676591 GAGATCACCCAGGAAGACCATGG + Intergenic
948468111 2:238161848-238161870 GAGAGAACCCAGGCAGCCCCAGG + Intronic
948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG + Intronic
1169426344 20:5500396-5500418 AAGATCACACAGCCAGCCCAAGG + Intergenic
1170525645 20:17233631-17233653 GAGAAAGCCCATTCAGGCCATGG + Intronic
1170802936 20:19605042-19605064 TAGAACACTCAGTCTGACCACGG + Intronic
1172179114 20:32989879-32989901 GAAAGCACCCAGTGAACCCAGGG - Intronic
1174270996 20:49368329-49368351 AAGAAAACCCAAACAGCCCAAGG + Exonic
1174654479 20:52159027-52159049 GTGGACAGCCAGCCAGCCCATGG + Intronic
1174858650 20:54069775-54069797 CAGGGCACCCAGCCAGCCCAGGG + Intronic
1175641766 20:60636126-60636148 GAGCCCACCCAGACAGCCCAGGG + Intergenic
1175860396 20:62147356-62147378 GAGAACACCCAGCCAGGCCCAGG - Intronic
1179637725 21:42724177-42724199 GAGCGCACCCTGTCACCCCAAGG + Intronic
1180237494 21:46472476-46472498 TACAGAACCCAGTCAGCCCAAGG + Intronic
1181968316 22:26671899-26671921 CAGAACACCCAGAGAGGCCAGGG - Intergenic
1182017291 22:27051483-27051505 GAGATCACACAGTCAGCCAAAGG + Intergenic
1182635902 22:31726827-31726849 CAAAACACCCAGTCAGGACAGGG + Intronic
1183213623 22:36465765-36465787 AAAGACACCCAGTGAGCCCAGGG - Intergenic
1183287634 22:36977423-36977445 GAGAACACCCCAGCAGGCCAAGG + Intergenic
1184930745 22:47679471-47679493 GAGAAGACATAGTCTGCCCAAGG + Intergenic
1185187871 22:49413688-49413710 GAGAACACAGAGCCGGCCCAGGG - Intergenic
952774848 3:37035389-37035411 GTGAACACCCAGTCAGTGGAGGG - Intronic
952835742 3:37600534-37600556 GAGAACAGCCAGGCAGAGCAGGG + Intronic
954271491 3:49513282-49513304 GAGGACACCTAAGCAGCCCATGG - Intronic
961338875 3:126203909-126203931 GGGAGGACCCAGGCAGCCCAGGG - Intergenic
962610122 3:137068572-137068594 GAGAACATCAAGTCAGTGCAGGG + Intergenic
963526967 3:146427275-146427297 GAGAACAATCAGTCAAGCCATGG + Intronic
964437946 3:156674235-156674257 GAGAAGACCCAGACACCCGAGGG - Intronic
964726480 3:159819152-159819174 GAAAACACACAAACAGCCCACGG - Intronic
966460154 3:180167546-180167568 GAGAACACACAGACAACACAGGG + Intergenic
968514042 4:1009010-1009032 GAGAAAACCCAGGCAGCCACCGG - Intergenic
968542610 4:1175606-1175628 GAGAACCCCCACCCAGGCCAGGG - Intronic
969296058 4:6271085-6271107 GAGAACAGGCAGCCAGCACATGG - Intronic
972650577 4:41013834-41013856 GAGAAATCCCAGCCAGTCCAGGG - Exonic
978965264 4:114733007-114733029 GATAGCACCCAGTCAGAGCAAGG + Intergenic
979850905 4:125570220-125570242 GAAAACAGCCATACAGCCCAAGG - Intergenic
981651796 4:147068658-147068680 GAGAACACCCAGGCTGACCTTGG - Intergenic
982424477 4:155242261-155242283 GGGCCCACACAGTCAGCCCAGGG - Intergenic
984614531 4:181881756-181881778 TAGAAAACCCAGGCAACCCAAGG - Intergenic
985774954 5:1836678-1836700 GACAACACGCAGTCAGCCCGCGG - Intergenic
989619620 5:43371533-43371555 GAGAATACTCAGACAGCTCATGG + Intergenic
992164137 5:74031743-74031765 AAGACCACCCAGGCAGCACAGGG - Intergenic
993482707 5:88444481-88444503 CAAAATACCAAGTCAGCCCATGG + Intergenic
993498860 5:88640556-88640578 GAGAACACTCAGTAATCACATGG - Intergenic
996054651 5:118969303-118969325 CAGCACACCCACTCAGCCAAAGG + Intronic
1000799451 5:165706223-165706245 GAGAACAACCAGTAAGCAAATGG - Intergenic
1004379109 6:15116926-15116948 GAGAAGACCCAGCCAGACCTGGG + Intergenic
1006497359 6:34433399-34433421 GAAAACAGCCCTTCAGCCCATGG - Intergenic
1007741392 6:44011935-44011957 GCAACCACCCAGTGAGCCCAAGG - Intergenic
1012404987 6:98885920-98885942 GAGGACACTCAGGCAGCCTATGG + Intronic
1021176625 7:17457532-17457554 GAGAACACTCAAGCAGCACATGG - Intergenic
1022804553 7:33808635-33808657 GGCAACACACAGTCAGCTCAAGG - Intergenic
1023370482 7:39508101-39508123 GAGAACACTCATGCAGCCCTGGG - Intergenic
1024658402 7:51471577-51471599 GAGCAAAGCCTGTCAGCCCAGGG - Intergenic
1024863816 7:53880067-53880089 GAGAAAACACAGTCAACACATGG - Intergenic
1025036444 7:55595449-55595471 GAGGACATTCAGTCAGCCTATGG - Intergenic
1025073058 7:55918194-55918216 GAGGAAACCCAGACAGCCCATGG + Intronic
1027141236 7:75659203-75659225 TAGGACACCTAGTGAGCCCAAGG - Intronic
1029510329 7:100990519-100990541 GAAGACACCTGGTCAGCCCATGG - Intronic
1029513045 7:101008771-101008793 GGGCACACCCAGACACCCCAGGG + Intronic
1029985924 7:104923250-104923272 GAGGACAGGCAGGCAGCCCATGG + Intergenic
1033579568 7:142719817-142719839 GAGAACAACCTTTCTGCCCAGGG + Intergenic
1034694815 7:153044001-153044023 GAGAACACCCTTTCAGCCATGGG + Intergenic
1035766780 8:2112890-2112912 GAGAAGACTCCGTCAGCCCTTGG - Intronic
1037672702 8:21028976-21028998 CAGGACACACACTCAGCCCATGG - Intergenic
1037859338 8:22393434-22393456 GAGAAAAACCATCCAGCCCATGG - Intronic
1038241961 8:25818255-25818277 GAGCCCACCCTGCCAGCCCAAGG - Intergenic
1038245364 8:25849954-25849976 GAAAATGCCCAGTCACCCCAGGG - Intronic
1039389340 8:37164740-37164762 AAGAACACTCAGTCAGCAAAGGG - Intergenic
1039790090 8:40868705-40868727 GAGATCACCCAGTCAGCTTTAGG - Intronic
1041678415 8:60561020-60561042 GAGAACACACAGTCAACCCAAGG - Intronic
1042058185 8:64788415-64788437 GAGAACACCCATGCAGACCTGGG - Intronic
1043471298 8:80565900-80565922 GAGAACACCCACGCAGGCCAAGG - Intergenic
1046049306 8:109002672-109002694 GATAAAACCCAGGCAGTCCATGG + Intergenic
1048750787 8:137671812-137671834 TAAATCACCCAGTCAGCTCATGG + Intergenic
1049005459 8:139852753-139852775 CAGAGCTCCCAGCCAGCCCAAGG - Intronic
1050749095 9:8916039-8916061 GAGAACACTAAGGAAGCCCAAGG + Intronic
1051604720 9:18908180-18908202 GAAAACAAGCAGACAGCCCAGGG + Intronic
1053290971 9:36879508-36879530 GAGCACACCCAGGCAGCCCAGGG + Intronic
1054916754 9:70501558-70501580 GAGAAGACACATTCAGTCCATGG - Intergenic
1056744692 9:89290199-89290221 CAGAGAACCCAGTGAGCCCAGGG + Intergenic
1058951227 9:109905828-109905850 GAGAAGAAACAGTCAGGCCAGGG + Intronic
1059614261 9:115931847-115931869 GAGCACAGCATGTCAGCCCAGGG - Intergenic
1060868822 9:127022633-127022655 GAGAACAGCAAGGTAGCCCATGG - Intronic
1060914205 9:127375826-127375848 GAGGACACTCAAGCAGCCCAGGG + Intronic
1062339121 9:136086112-136086134 GAGAAAACCAAGTCACCCCTGGG + Intronic
1062353576 9:136151425-136151447 GAGAATACCCAAACAGCCGAAGG + Intergenic
1062629607 9:137457977-137457999 GAGAACACCCAGTGGGCACCTGG + Intronic
1185456012 X:311273-311295 TCGGACACCCACTCAGCCCAGGG - Intronic
1185456025 X:311305-311327 TCGGACACCCACTCAGCCCAGGG - Intronic
1189606583 X:42684384-42684406 AAAAACACCCAGATAGCCCACGG - Intergenic
1199314700 X:146363281-146363303 TAGAACACCAAGTCAGCTCCTGG - Intergenic
1200233933 X:154459290-154459312 GGCCACACCCAGTCAGCCCCAGG - Intronic