ID: 911057358

View in Genome Browser
Species Human (GRCh38)
Location 1:93720398-93720420
Sequence TGTGTGCTCTTGGGCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911057352_911057358 13 Left 911057352 1:93720362-93720384 CCTGGACTCTGGAGGCTGGTGCC No data
Right 911057358 1:93720398-93720420 TGTGTGCTCTTGGGCAAAACAGG No data
911057354_911057358 -8 Left 911057354 1:93720383-93720405 CCACTCTTTCCTGGCTGTGTGCT 0: 1
1: 0
2: 5
3: 45
4: 507
Right 911057358 1:93720398-93720420 TGTGTGCTCTTGGGCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911057358 Original CRISPR TGTGTGCTCTTGGGCAAAAC AGG Intronic
No off target data available for this crispr