ID: 911057378

View in Genome Browser
Species Human (GRCh38)
Location 1:93720535-93720557
Sequence CTGTGGTCTGGGAAGGCGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911057378_911057386 2 Left 911057378 1:93720535-93720557 CCACTCGCCTTCCCAGACCACAG No data
Right 911057386 1:93720560-93720582 CCTGATGGAGACCCGAAGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 80
911057378_911057389 14 Left 911057378 1:93720535-93720557 CCACTCGCCTTCCCAGACCACAG No data
Right 911057389 1:93720572-93720594 CCGAAGTTGGGTCGATGCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 17
911057378_911057384 1 Left 911057378 1:93720535-93720557 CCACTCGCCTTCCCAGACCACAG No data
Right 911057384 1:93720559-93720581 GCCTGATGGAGACCCGAAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911057378 Original CRISPR CTGTGGTCTGGGAAGGCGAG TGG (reversed) Intronic
No off target data available for this crispr