ID: 911061489

View in Genome Browser
Species Human (GRCh38)
Location 1:93751774-93751796
Sequence AGGCTGCCAGCCTGTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061489_911061499 10 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061499 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
911061489_911061502 24 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061489_911061495 -1 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061495 1:93751796-93751818 TCCAGACTGCTCCAACACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 305
911061489_911061497 6 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061497 1:93751803-93751825 TGCTCCAACACAAGGGCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 72
911061489_911061494 -2 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061494 1:93751795-93751817 CTCCAGACTGCTCCAACACAAGG No data
911061489_911061501 12 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061501 1:93751809-93751831 AACACAAGGGCGTGTGGCTGGGG No data
911061489_911061500 11 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061500 1:93751808-93751830 CAACACAAGGGCGTGTGGCTGGG No data
911061489_911061503 29 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061489 Original CRISPR AGGCTGCCAGCCTGTGGGGC TGG (reversed) Intronic