ID: 911061490

View in Genome Browser
Species Human (GRCh38)
Location 1:93751778-93751800
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 432}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061490_911061502 20 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061490_911061499 6 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061499 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
911061490_911061503 25 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704
911061490_911061497 2 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061497 1:93751803-93751825 TGCTCCAACACAAGGGCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 72
911061490_911061494 -6 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061494 1:93751795-93751817 CTCCAGACTGCTCCAACACAAGG No data
911061490_911061501 8 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061501 1:93751809-93751831 AACACAAGGGCGTGTGGCTGGGG No data
911061490_911061500 7 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061500 1:93751808-93751830 CAACACAAGGGCGTGTGGCTGGG No data
911061490_911061495 -5 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061495 1:93751796-93751818 TCCAGACTGCTCCAACACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061490 Original CRISPR CTGGAGGCTGCCAGCCTGTG GGG (reversed) Intronic