ID: 911061493

View in Genome Browser
Species Human (GRCh38)
Location 1:93751794-93751816
Sequence CTTGTGTTGGAGCAGTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 175}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061493_911061508 27 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061508 1:93751844-93751866 CAAGGCCTCCCCAGCCTGGCGGG No data
911061493_911061503 9 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704
911061493_911061502 4 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061493_911061501 -8 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061501 1:93751809-93751831 AACACAAGGGCGTGTGGCTGGGG No data
911061493_911061499 -10 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061499 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
911061493_911061507 26 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061507 1:93751843-93751865 GCAAGGCCTCCCCAGCCTGGCGG 0: 1
1: 0
2: 34
3: 335
4: 4461
911061493_911061506 23 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061506 1:93751840-93751862 CTGGCAAGGCCTCCCCAGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 485
911061493_911061509 28 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061509 1:93751845-93751867 AAGGCCTCCCCAGCCTGGCGGGG 0: 1
1: 0
2: 3
3: 32
4: 252
911061493_911061500 -9 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061500 1:93751808-93751830 CAACACAAGGGCGTGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061493 Original CRISPR CTTGTGTTGGAGCAGTCTGG AGG (reversed) Intronic