ID: 911061495

View in Genome Browser
Species Human (GRCh38)
Location 1:93751796-93751818
Sequence TCCAGACTGCTCCAACACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 305}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061485_911061495 20 Left 911061485 1:93751753-93751775 CCCACATGCTGGTGCTCTCAGCC 0: 1
1: 0
2: 0
3: 13
4: 184
Right 911061495 1:93751796-93751818 TCCAGACTGCTCCAACACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 305
911061491_911061495 -6 Left 911061491 1:93751779-93751801 CCCACAGGCTGGCAGCCTCCAGA No data
Right 911061495 1:93751796-93751818 TCCAGACTGCTCCAACACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 305
911061490_911061495 -5 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061495 1:93751796-93751818 TCCAGACTGCTCCAACACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 305
911061492_911061495 -7 Left 911061492 1:93751780-93751802 CCACAGGCTGGCAGCCTCCAGAC 0: 1
1: 0
2: 5
3: 68
4: 481
Right 911061495 1:93751796-93751818 TCCAGACTGCTCCAACACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 305
911061484_911061495 21 Left 911061484 1:93751752-93751774 CCCCACATGCTGGTGCTCTCAGC No data
Right 911061495 1:93751796-93751818 TCCAGACTGCTCCAACACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 305
911061489_911061495 -1 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061495 1:93751796-93751818 TCCAGACTGCTCCAACACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 305
911061486_911061495 19 Left 911061486 1:93751754-93751776 CCACATGCTGGTGCTCTCAGCCA No data
Right 911061495 1:93751796-93751818 TCCAGACTGCTCCAACACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061495 Original CRISPR TCCAGACTGCTCCAACACAA GGG Intronic