ID: 911061496

View in Genome Browser
Species Human (GRCh38)
Location 1:93751797-93751819
Sequence GCCCTTGTGTTGGAGCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061496_911061506 20 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061506 1:93751840-93751862 CTGGCAAGGCCTCCCCAGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 485
911061496_911061508 24 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061508 1:93751844-93751866 CAAGGCCTCCCCAGCCTGGCGGG No data
911061496_911061502 1 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061496_911061509 25 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061509 1:93751845-93751867 AAGGCCTCCCCAGCCTGGCGGGG 0: 1
1: 0
2: 3
3: 32
4: 252
911061496_911061507 23 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061507 1:93751843-93751865 GCAAGGCCTCCCCAGCCTGGCGG 0: 1
1: 0
2: 34
3: 335
4: 4461
911061496_911061503 6 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061496 Original CRISPR GCCCTTGTGTTGGAGCAGTC TGG (reversed) Intronic