ID: 911061498

View in Genome Browser
Species Human (GRCh38)
Location 1:93751807-93751829
Sequence CCAGCCACACGCCCTTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061498_911061506 10 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061506 1:93751840-93751862 CTGGCAAGGCCTCCCCAGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 485
911061498_911061502 -9 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061498_911061508 14 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061508 1:93751844-93751866 CAAGGCCTCCCCAGCCTGGCGGG No data
911061498_911061507 13 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061507 1:93751843-93751865 GCAAGGCCTCCCCAGCCTGGCGG 0: 1
1: 0
2: 34
3: 335
4: 4461
911061498_911061503 -4 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704
911061498_911061509 15 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061509 1:93751845-93751867 AAGGCCTCCCCAGCCTGGCGGGG 0: 1
1: 0
2: 3
3: 32
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061498 Original CRISPR CCAGCCACACGCCCTTGTGT TGG (reversed) Intronic