ID: 911061502

View in Genome Browser
Species Human (GRCh38)
Location 1:93751821-93751843
Sequence TGTGGCTGGGGCTGCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061491_911061502 19 Left 911061491 1:93751779-93751801 CCCACAGGCTGGCAGCCTCCAGA No data
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061492_911061502 18 Left 911061492 1:93751780-93751802 CCACAGGCTGGCAGCCTCCAGAC 0: 1
1: 0
2: 5
3: 68
4: 481
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061498_911061502 -9 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061496_911061502 1 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061489_911061502 24 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061493_911061502 4 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data
911061490_911061502 20 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061502 1:93751821-93751843 TGTGGCTGGGGCTGCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061502 Original CRISPR TGTGGCTGGGGCTGCTGCCC TGG Intronic