ID: 911061503

View in Genome Browser
Species Human (GRCh38)
Location 1:93751826-93751848
Sequence CTGGGGCTGCTGCCCTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 796
Summary {0: 1, 1: 0, 2: 7, 3: 84, 4: 704}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061493_911061503 9 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704
911061492_911061503 23 Left 911061492 1:93751780-93751802 CCACAGGCTGGCAGCCTCCAGAC 0: 1
1: 0
2: 5
3: 68
4: 481
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704
911061498_911061503 -4 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704
911061490_911061503 25 Left 911061490 1:93751778-93751800 CCCCACAGGCTGGCAGCCTCCAG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704
911061491_911061503 24 Left 911061491 1:93751779-93751801 CCCACAGGCTGGCAGCCTCCAGA No data
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704
911061496_911061503 6 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704
911061489_911061503 29 Left 911061489 1:93751774-93751796 CCAGCCCCACAGGCTGGCAGCCT No data
Right 911061503 1:93751826-93751848 CTGGGGCTGCTGCCCTGGCAAGG 0: 1
1: 0
2: 7
3: 84
4: 704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061503 Original CRISPR CTGGGGCTGCTGCCCTGGCA AGG Intronic