ID: 911061506

View in Genome Browser
Species Human (GRCh38)
Location 1:93751840-93751862
Sequence CTGGCAAGGCCTCCCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 485}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061493_911061506 23 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061506 1:93751840-93751862 CTGGCAAGGCCTCCCCAGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 485
911061498_911061506 10 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061506 1:93751840-93751862 CTGGCAAGGCCTCCCCAGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 485
911061496_911061506 20 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061506 1:93751840-93751862 CTGGCAAGGCCTCCCCAGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061506 Original CRISPR CTGGCAAGGCCTCCCCAGCC TGG Intronic