ID: 911061507 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:93751843-93751865 |
Sequence | GCAAGGCCTCCCCAGCCTGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 4831 | |||
Summary | {0: 1, 1: 0, 2: 34, 3: 335, 4: 4461} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
911061493_911061507 | 26 | Left | 911061493 | 1:93751794-93751816 | CCTCCAGACTGCTCCAACACAAG | 0: 1 1: 0 2: 1 3: 7 4: 175 |
||
Right | 911061507 | 1:93751843-93751865 | GCAAGGCCTCCCCAGCCTGGCGG | 0: 1 1: 0 2: 34 3: 335 4: 4461 |
||||
911061496_911061507 | 23 | Left | 911061496 | 1:93751797-93751819 | CCAGACTGCTCCAACACAAGGGC | No data | ||
Right | 911061507 | 1:93751843-93751865 | GCAAGGCCTCCCCAGCCTGGCGG | 0: 1 1: 0 2: 34 3: 335 4: 4461 |
||||
911061498_911061507 | 13 | Left | 911061498 | 1:93751807-93751829 | CCAACACAAGGGCGTGTGGCTGG | No data | ||
Right | 911061507 | 1:93751843-93751865 | GCAAGGCCTCCCCAGCCTGGCGG | 0: 1 1: 0 2: 34 3: 335 4: 4461 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
911061507 | Original CRISPR | GCAAGGCCTCCCCAGCCTGG CGG | Intronic | ||