ID: 911061507

View in Genome Browser
Species Human (GRCh38)
Location 1:93751843-93751865
Sequence GCAAGGCCTCCCCAGCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4831
Summary {0: 1, 1: 0, 2: 34, 3: 335, 4: 4461}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061493_911061507 26 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061507 1:93751843-93751865 GCAAGGCCTCCCCAGCCTGGCGG 0: 1
1: 0
2: 34
3: 335
4: 4461
911061496_911061507 23 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061507 1:93751843-93751865 GCAAGGCCTCCCCAGCCTGGCGG 0: 1
1: 0
2: 34
3: 335
4: 4461
911061498_911061507 13 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061507 1:93751843-93751865 GCAAGGCCTCCCCAGCCTGGCGG 0: 1
1: 0
2: 34
3: 335
4: 4461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061507 Original CRISPR GCAAGGCCTCCCCAGCCTGG CGG Intronic