ID: 911061509

View in Genome Browser
Species Human (GRCh38)
Location 1:93751845-93751867
Sequence AAGGCCTCCCCAGCCTGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911061496_911061509 25 Left 911061496 1:93751797-93751819 CCAGACTGCTCCAACACAAGGGC No data
Right 911061509 1:93751845-93751867 AAGGCCTCCCCAGCCTGGCGGGG 0: 1
1: 0
2: 3
3: 32
4: 252
911061493_911061509 28 Left 911061493 1:93751794-93751816 CCTCCAGACTGCTCCAACACAAG 0: 1
1: 0
2: 1
3: 7
4: 175
Right 911061509 1:93751845-93751867 AAGGCCTCCCCAGCCTGGCGGGG 0: 1
1: 0
2: 3
3: 32
4: 252
911061498_911061509 15 Left 911061498 1:93751807-93751829 CCAACACAAGGGCGTGTGGCTGG No data
Right 911061509 1:93751845-93751867 AAGGCCTCCCCAGCCTGGCGGGG 0: 1
1: 0
2: 3
3: 32
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911061509 Original CRISPR AAGGCCTCCCCAGCCTGGCG GGG Intronic