ID: 911062352

View in Genome Browser
Species Human (GRCh38)
Location 1:93759245-93759267
Sequence AAGCTAAGCATAGTATAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911062346_911062352 17 Left 911062346 1:93759205-93759227 CCACCAACAAAAAACCATTATGA No data
Right 911062352 1:93759245-93759267 AAGCTAAGCATAGTATAGACAGG 0: 1
1: 0
2: 0
3: 4
4: 102
911062347_911062352 14 Left 911062347 1:93759208-93759230 CCAACAAAAAACCATTATGATAA 0: 1
1: 0
2: 3
3: 46
4: 379
Right 911062352 1:93759245-93759267 AAGCTAAGCATAGTATAGACAGG 0: 1
1: 0
2: 0
3: 4
4: 102
911062350_911062352 3 Left 911062350 1:93759219-93759241 CCATTATGATAACAGGAAGGCGC No data
Right 911062352 1:93759245-93759267 AAGCTAAGCATAGTATAGACAGG 0: 1
1: 0
2: 0
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911062352 Original CRISPR AAGCTAAGCATAGTATAGAC AGG Intronic
909814809 1:79978318-79978340 AAGGAAAGCATTGTATACACTGG + Intergenic
910941807 1:92543930-92543952 AAGCAAAGCATAATAAAGCCAGG + Intronic
911062352 1:93759245-93759267 AAGCTAAGCATAGTATAGACAGG + Intronic
921064914 1:211615853-211615875 AATTAAAGCAGAGTATAGACAGG - Intergenic
922819150 1:228471888-228471910 AAGCTAACCTGAGTCTAGACTGG + Intergenic
1067099580 10:43324812-43324834 AAGCTAAACAAAGTGCAGACAGG + Intergenic
1069187162 10:65438844-65438866 AAATTAAGCATAGTATTGAGAGG + Intergenic
1069503811 10:68978574-68978596 AAGCTGAGCAGAGTATACAAAGG - Intronic
1073031064 10:100526296-100526318 AAGCCAAGCTTGGTATTGACTGG + Intronic
1073545115 10:104341005-104341027 CACCTATGCATAGTATAGGCAGG - Intergenic
1075355794 10:121773504-121773526 AAGCTGAGCATTGTGAAGACAGG - Intronic
1080362127 11:31527763-31527785 AAGCTAATCATAGTATATCTTGG + Intronic
1091956783 12:4650924-4650946 AAGCCAAGCAGAGTTTAGATCGG + Intronic
1095272677 12:40238412-40238434 AAGCCAAGCATAGGTTACACTGG + Intronic
1097486060 12:60202691-60202713 AAGCTGAGCAGAATATAGACAGG - Intergenic
1098850263 12:75587808-75587830 GAGCCAAGCATAGTAAAGAATGG - Intergenic
1099125838 12:78756900-78756922 CAGCTAATCTTAGTATAAACTGG + Intergenic
1105633500 13:22195221-22195243 AAACTAAGCATATAATATACTGG - Intergenic
1112090700 13:96080257-96080279 AAGCTAAGCAGAGTTGAGCCTGG - Intergenic
1114841000 14:26261634-26261656 TAGCTAAGGATATTACAGACAGG - Intergenic
1116438897 14:44928291-44928313 ATGCTAACCATAGCATAGATAGG + Exonic
1116989971 14:51265242-51265264 AAGCTAAAAATAGTATATATTGG + Intergenic
1117474261 14:56078000-56078022 AAGCATAGCATAGTTTGGACAGG + Intergenic
1121521510 14:94589106-94589128 AAGCTAAGGACGGTATTGACTGG + Intronic
1122412196 14:101531373-101531395 ATGTGAAGCATAGTATAGCCGGG - Intergenic
1126229729 15:46310770-46310792 TAGCTAAGCAGAGTAAACACTGG + Intergenic
1128212084 15:65909860-65909882 AAGCTACGCAAAGTGAAGACTGG - Intronic
1131933745 15:97477535-97477557 AAGCACAGCATAGTATATATAGG - Intergenic
1132213292 15:100042412-100042434 AATCTGTGCATAGTATATACAGG - Intronic
1133799347 16:9072457-9072479 AACCTAAGCATAAAATAGACAGG - Intergenic
1137057628 16:35753105-35753127 AAGCTAAGCAGGGTCAAGACTGG + Intergenic
1138988272 16:62358779-62358801 ATCCTAAGAATAGTAAAGACTGG + Intergenic
1144500455 17:15782379-15782401 AAGCTAAGCAGGGTCTAGCCTGG + Intergenic
1146141967 17:30376128-30376150 AATTAAAGCATAGCATAGACCGG - Intergenic
1153999318 18:10470441-10470463 AAGATAAGCATTATTTAGACAGG - Intronic
1155285915 18:24288951-24288973 AAGCTAAGCAGAGTCAAGCCTGG + Intronic
1158299845 18:56039063-56039085 AAACTAAGCATTGTGTAGAGGGG - Intergenic
1164322342 19:24160688-24160710 AATCTATGCTTAGTAGAGACGGG + Intergenic
1164492871 19:28730354-28730376 AAGCATAGTATAGTATATACAGG + Intergenic
928401356 2:30980908-30980930 CAGCTAATCTTAGTAGAGACGGG - Intronic
929985151 2:46723093-46723115 ATGAAAAGCAAAGTATAGACTGG - Intronic
933166676 2:79084140-79084162 AAGATAAGCAGAGTTCAGACAGG + Intergenic
933814614 2:86055602-86055624 AGGCTAGGCATAGTCAAGACTGG + Intronic
935199952 2:100847837-100847859 AAGCCAAGAATAGTGTAGAAGGG + Intronic
938740898 2:134231243-134231265 AAGCTAAGCAGAGTTGAGCCTGG + Intronic
939662432 2:144906568-144906590 AACCTAAGCATGGTATACAGAGG + Intergenic
939787828 2:146538658-146538680 TTGCTAAGCATAGCAGAGACTGG + Intergenic
940016577 2:149112449-149112471 AAGCTATGCAGAGAAAAGACAGG + Intronic
944564251 2:200971364-200971386 CAGCTAATTTTAGTATAGACAGG + Intergenic
1171219374 20:23380942-23380964 AAGCTAAGCAGTGTAGAGCCTGG - Intronic
1173909385 20:46652788-46652810 AAGCTAAGCATTGCAAATACTGG - Intronic
1176990003 21:15484305-15484327 AAGCCAAGCAAAGTAAATACCGG + Intergenic
951187513 3:19730846-19730868 AAGCTCAGGATAGTCTAAACGGG + Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
955673167 3:61423754-61423776 AAGCTAAACATTGAATACACAGG + Intergenic
958124951 3:89343842-89343864 AAGCAAAGCAAAGCATATACTGG - Intronic
959286877 3:104426025-104426047 AAGCTAAGAATGGTATAGAAGGG + Intergenic
960047062 3:113209230-113209252 AAGCAACGAATAGTATATACAGG + Intergenic
962308536 3:134309989-134310011 AAACTAAGAATGGTAAAGACAGG - Intergenic
963536705 3:146538526-146538548 AAGCTAAGCATGTTATAGAGAGG - Intronic
973147848 4:46850754-46850776 TAGCTGAGCATAGTATTGGCAGG - Intronic
976712802 4:88090892-88090914 AAGCTGAGCAAAGAGTAGACAGG + Exonic
978704335 4:111688427-111688449 GAGCTATGCATATTATTGACAGG - Intergenic
979615416 4:122737152-122737174 GATTTAAGCATAGTATAGAAAGG + Intronic
981571784 4:146159531-146159553 TACCTAAGCAGAGTCTAGACCGG + Intergenic
982941665 4:161566298-161566320 AAGCTAAGCATAGTATTCTATGG + Intronic
983351249 4:166592920-166592942 AAGCTAAGTATACTAAAGAGAGG - Intergenic
984484150 4:180345325-180345347 AAGCATACCATAGTATATACTGG - Intergenic
987277700 5:16378999-16379021 AAGCTAAGCTTAGTTCACACAGG + Intergenic
989563738 5:42879911-42879933 AATCTAAGCATAAATTAGACTGG + Intronic
990635874 5:57725670-57725692 TAGCTAGGCATAAAATAGACAGG + Intergenic
994019637 5:95008023-95008045 AAGATAAGCAAAGTTTAGGCAGG - Intronic
994271684 5:97784670-97784692 AAGGTAAGTATAGTCTAAACTGG + Intergenic
994381373 5:99075864-99075886 GAGCTAAGCAACGTAAAGACTGG - Intergenic
995231518 5:109770118-109770140 TATCTAAGCATAGCAGAGACAGG - Intronic
995658234 5:114450879-114450901 AAGCTAAGAAAATTATAAACAGG - Intronic
995817988 5:116193057-116193079 AAGCTAAGCATCATATATAAAGG + Intronic
996969039 5:129341578-129341600 AATCAGAGCATAGTATAAACAGG + Intergenic
1005586973 6:27286591-27286613 AAGCTAGGCAGAGTAAACACAGG - Intronic
1011655561 6:89548669-89548691 AAGCCCAGCATATTATAGAGAGG + Intronic
1016164366 6:140922264-140922286 AAACTGAGCATAGGATATACTGG - Intergenic
1018513163 6:164548863-164548885 AAGTTAAGTACAGAATAGACAGG - Intergenic
1019838980 7:3419823-3419845 AAACTAAGCTTAGTATGGCCTGG + Intronic
1021712196 7:23426953-23426975 ATACTAAGTATAGTAAAGACAGG + Intronic
1024354300 7:48398630-48398652 AAGATAAGCATAGTCAAGAGAGG + Intronic
1024932279 7:54676229-54676251 AAGCTAAGCATTTTATACAGTGG - Intergenic
1028120761 7:87054278-87054300 TAGCAGAGCATAGTATAGAGTGG - Intronic
1030939733 7:115631132-115631154 AAGCACAGAATAGAATAGACTGG - Intergenic
1031103433 7:117510618-117510640 AAGCCAAGCAGAGCATAGAAAGG - Intronic
1033605066 7:142920990-142921012 AAGCACAGCACATTATAGACAGG - Intronic
1035260063 7:157655442-157655464 GAGTTAATAATAGTATAGACTGG - Intronic
1036587698 8:10140073-10140095 AACCTAAGCATACAATACACAGG - Intronic
1039083119 8:33753917-33753939 AAACTAAGCATCGTATAGGAAGG - Intergenic
1043989934 8:86740268-86740290 AAGCTATGCACAGTCTAGAAGGG + Intronic
1044684285 8:94812248-94812270 AAACTAAGCATACAATGGACAGG - Intergenic
1044802095 8:95967610-95967632 AAGCTATTCATAGCAGAGACAGG - Intergenic
1046953290 8:120038426-120038448 AAGCTAAGTTTTGTAGAGACAGG - Intronic
1049478240 8:142806804-142806826 AAGCTAAGCCTACCCTAGACAGG - Intergenic
1055191682 9:73532000-73532022 CAGCTAAAGATAGTATAAACTGG + Intergenic
1055648546 9:78384327-78384349 AAGCAAGGCAAAGTATAGCCAGG + Intergenic
1056190607 9:84180816-84180838 ACGCTATACACAGTATAGACTGG + Intergenic
1058156553 9:101522971-101522993 AAGCTAAGCATCATATAGGAAGG - Intronic
1187645970 X:21347923-21347945 AAGCTAAGCATACTCTAAATAGG - Intergenic
1188631511 X:32368105-32368127 AAGCTCAGCATAGTATTTAAAGG - Intronic
1193753594 X:85378937-85378959 AATCTAACCATAGTATAGGAAGG - Intronic
1197304127 X:124819956-124819978 AGGCTAATCTTAGTAGAGACAGG + Intronic
1198980911 X:142394931-142394953 AAGCTAAGCACAGCATCCACGGG - Intergenic