ID: 911063183

View in Genome Browser
Species Human (GRCh38)
Location 1:93764925-93764947
Sequence ACATGTGTGCTACAGTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911063183_911063190 18 Left 911063183 1:93764925-93764947 CCGCCCCACTGTAGCACACATGT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 911063190 1:93764966-93764988 TGGGACCTCGCTCTTACGCCAGG No data
911063183_911063188 -1 Left 911063183 1:93764925-93764947 CCGCCCCACTGTAGCACACATGT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 911063188 1:93764947-93764969 TTTGCATCTCCTGTTCAAGTGGG No data
911063183_911063192 29 Left 911063183 1:93764925-93764947 CCGCCCCACTGTAGCACACATGT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 911063192 1:93764977-93764999 TCTTACGCCAGGCAGCCCTAAGG No data
911063183_911063187 -2 Left 911063183 1:93764925-93764947 CCGCCCCACTGTAGCACACATGT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 911063187 1:93764946-93764968 GTTTGCATCTCCTGTTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911063183 Original CRISPR ACATGTGTGCTACAGTGGGG CGG (reversed) Intronic
901543861 1:9940671-9940693 ACATGTGTACTTCATTGGAGAGG + Intronic
902189790 1:14754237-14754259 TTATGTGGGATACAGTGGGGAGG + Intronic
904443899 1:30551892-30551914 GCATGCGAGCTGCAGTGGGGTGG - Intergenic
906280238 1:44548278-44548300 TCATGTGAGCAGCAGTGGGGAGG - Intronic
910417156 1:87013220-87013242 AGAGGTGTGCTACAGTCGTGGGG - Intronic
911063183 1:93764925-93764947 ACATGTGTGCTACAGTGGGGCGG - Intronic
913315631 1:117548905-117548927 ACATATGTGATACAGTGATGAGG + Intergenic
913563063 1:120042652-120042674 TAATGTGTGCTTTAGTGGGGAGG - Intronic
913635060 1:120750938-120750960 TAATGTGTGCTTTAGTGGGGAGG + Intergenic
914283659 1:146202014-146202036 TAATGTGTGCTTTAGTGGGGAGG - Intronic
914544690 1:148652750-148652772 TAATGTGTGCTTTAGTGGGGAGG - Intronic
914621937 1:149418259-149418281 TAATGTGTGCTTTAGTGGGGAGG + Intergenic
915610702 1:156989716-156989738 AAATGTGTGCTGCAGTGGTCAGG - Intronic
918138701 1:181701552-181701574 ATCTGTGTGCTACAATGAGGTGG + Intronic
1065380814 10:25088180-25088202 AAATGTGTTATACAGTGAGGAGG + Intergenic
1068454829 10:57240498-57240520 ACATTCATGCTACATTGGGGAGG - Intergenic
1069206859 10:65700401-65700423 GCATGTGTGCTACATTGTTGTGG + Intergenic
1071425808 10:85548218-85548240 ACATGTGTGCCACCCTGTGGTGG - Intergenic
1072826624 10:98613345-98613367 ACATGTGTGGGAGACTGGGGTGG - Intronic
1075841520 10:125508672-125508694 ACAGCTGTGCTTCTGTGGGGTGG - Intergenic
1078507444 11:11962964-11962986 AGAGGTGTGCTTCAGTTGGGTGG + Intergenic
1079115864 11:17640413-17640435 AAATGTGTGCTGGGGTGGGGAGG - Intronic
1083756982 11:64797079-64797101 AAGAGGGTGCTACAGTGGGGTGG - Intronic
1084970008 11:72766299-72766321 ACCTGTGTGCAACTGTGTGGTGG + Intronic
1089333505 11:117706646-117706668 ACAGGTGTGCAGCATTGGGGAGG + Intronic
1092230999 12:6775222-6775244 AGCTGGGTGCTGCAGTGGGGAGG - Intronic
1094027013 12:25969729-25969751 ACAGGGGTTCTCCAGTGGGGTGG + Intronic
1096351055 12:50901892-50901914 AGATGTGTTCTACAGTCAGGTGG - Intergenic
1102566172 12:113798826-113798848 AGATGTGAGCTTCAGGGGGGCGG + Intergenic
1106118306 13:26836468-26836490 ACATGTGAGCTGCAGGGGGTGGG + Intergenic
1107514699 13:41117831-41117853 ACAAGTGTTCTGCAGTGGGCAGG + Intergenic
1111707463 13:91768792-91768814 ACATGTGTGGTACATTGGTTTGG + Intronic
1113767755 13:112891592-112891614 GCAGGTGTGCTACAGTGCGGCGG + Intergenic
1115102306 14:29717261-29717283 AAATGTGTAGTGCAGTGGGGTGG + Intronic
1116288586 14:43004382-43004404 AGATGTTTTCTACAGTTGGGAGG + Intergenic
1118564669 14:67126363-67126385 ACCTGTGTACTACTGTGGGCTGG + Intronic
1119531700 14:75366138-75366160 ACTTATGTGCTGCAGTGGGCTGG + Intergenic
1120054939 14:79913086-79913108 ACATGTCTGATACAGTTGGCAGG + Intergenic
1124190545 15:27572851-27572873 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190552 15:27572897-27572919 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190559 15:27572943-27572965 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1125216601 15:37282819-37282841 GCAAGTGTGCTGCACTGGGGGGG + Intergenic
1126292789 15:47100167-47100189 TCATGTCAGCTGCAGTGGGGAGG - Intergenic
1126693757 15:51308583-51308605 ACATGTGAGCCATACTGGGGAGG - Intronic
1134317298 16:13130753-13130775 ACATTTGTGCTACTGTGGCAGGG - Intronic
1134562925 16:15226360-15226382 ACAGCAGAGCTACAGTGGGGTGG + Intergenic
1134865562 16:17603942-17603964 ACAAGTGTGATGCAGGGGGGGGG - Intergenic
1134923462 16:18137993-18138015 ACAGCAGAGCTACAGTGGGGTGG + Intergenic
1136230716 16:28883749-28883771 ACAGGTGTGGAAGAGTGGGGCGG - Intronic
1137506912 16:49062022-49062044 CCATGTGTGCTTGAGTGGGGAGG - Intergenic
1140213290 16:72987557-72987579 ACATGTATGCTTCAATGGTGTGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143287155 17:5798657-5798679 ACATGTGGGCTAAGGTGGGGAGG + Intronic
1144257418 17:13482948-13482970 ACATGTGTGCTATATTAAGGAGG - Intergenic
1146694539 17:34898477-34898499 TCTGGGGTGCTACAGTGGGGAGG + Intergenic
1146959849 17:36964759-36964781 AAAACTGAGCTACAGTGGGGGGG - Intronic
1147328866 17:39684612-39684634 ACAGGTGTGGTACATGGGGGAGG + Exonic
1151157945 17:72140057-72140079 AAGTGTGTTCTACAGTGTGGGGG - Intergenic
1151356105 17:73559607-73559629 ACATGTGTGGTATGGTGGCGGGG - Intronic
1156939930 18:42754912-42754934 ACAATTGTGCTACAGTGGGTAGG + Intronic
1157613537 18:48974275-48974297 ACGTGTGTGCTGCTGGGGGGCGG + Intergenic
1157813389 18:50713920-50713942 AAATATGTGCCACAGAGGGGAGG + Intronic
1160322502 18:77909567-77909589 AAATGTATGCAACAGTGTGGAGG - Intergenic
1165612627 19:37169618-37169640 CCATCTGTGCGACAGTGGAGAGG - Intronic
1165849611 19:38841881-38841903 ACATATGTGCTGCAGTGCGGTGG + Intronic
925415259 2:3665872-3665894 GAATGTGAGCTTCAGTGGGGTGG + Intronic
926001635 2:9338186-9338208 ACTTGTGTGCTTCTATGGGGAGG + Intronic
926246057 2:11123110-11123132 ATATGAGTGCCACAGTGGGCTGG - Intergenic
927011392 2:18908256-18908278 AAATCTGTGCTCCAGTGTGGTGG + Intergenic
927836467 2:26402785-26402807 ACATGTGTGCTCCAGACGGTGGG - Intronic
928980072 2:37128216-37128238 ACCTGTTTGCATCAGTGGGGCGG - Intronic
929547443 2:42864786-42864808 TCTTGTGTGATACATTGGGGCGG + Intergenic
934871195 2:97867655-97867677 GCATCTGTCCTAGAGTGGGGTGG + Intronic
937294076 2:120799251-120799273 AAGGGTGTGCTGCAGTGGGGTGG - Intronic
937730322 2:125222522-125222544 AGAAGTTTGCTACAGTGGTGGGG - Intergenic
938822796 2:134976041-134976063 CCATGTGTGCTACAATGCTGGGG + Intronic
941043396 2:160648157-160648179 TCATGTGGGCTGCAGTGGGGAGG + Intergenic
941335668 2:164240760-164240782 AGAAGTTTGCTACAGTGGTGGGG - Intergenic
941941213 2:171040362-171040384 ACATATGTGCCACTGTGGTGTGG + Intronic
942441605 2:176042664-176042686 ATATGTGTGCCACAGAGGGGAGG - Intergenic
946662934 2:222020302-222020324 ACACATGTGCTACAGAGGGTGGG + Intergenic
1168913449 20:1467886-1467908 AAATGTGGGCTACAGTGGTAGGG - Intronic
1171391416 20:24803777-24803799 ACATGTGTGGGACGGTGGAGTGG - Intergenic
1172912297 20:38418978-38419000 AGATGTCTGCCACAGTGGAGGGG - Intergenic
1172946508 20:38693511-38693533 ACAGCTTTGCTCCAGTGGGGTGG - Intergenic
1173729935 20:45321110-45321132 ACATGTGTGTTGCAGAGGGTGGG + Intergenic
1177037282 21:16060125-16060147 GCATGTGAGCTGCTGTGGGGTGG + Intergenic
1181828189 22:25537101-25537123 ACATGAGAGTTACAGTGGAGTGG - Intergenic
1184351563 22:43947455-43947477 AGTTGTGTGCTCCAGTGGAGAGG - Exonic
1184909516 22:47518715-47518737 ACACGTGAGCCACAGTGGGAAGG + Intergenic
950019906 3:9779931-9779953 GAATGTCTGTTACAGTGGGGAGG - Exonic
951123421 3:18956224-18956246 ACATATGAGATACAGTGGAGTGG - Intergenic
952326635 3:32326101-32326123 AGATGAGTGGTATAGTGGGGAGG - Intronic
955134082 3:56198890-56198912 ACTTCTGTGGTACAGTGGGCTGG - Intronic
956574478 3:70736655-70736677 ACATGCGTGCTAGGGTGGGGTGG - Intergenic
957618841 3:82568791-82568813 ACCTTAGTTCTACAGTGGGGGGG - Intergenic
957690516 3:83559886-83559908 ACAGGTGTCCTCCAGAGGGGAGG + Intergenic
958576267 3:95952713-95952735 ACATTTGTGCCATAGTGGAGTGG - Intergenic
959345541 3:105190275-105190297 ACTAGTGTGATACATTGGGGAGG - Intergenic
960721510 3:120628645-120628667 ATTTGTGTGCTAGAGTGGTGAGG + Intronic
961106984 3:124250530-124250552 CCTTGTGTCTTACAGTGGGGTGG + Intronic
961388269 3:126536680-126536702 CAGTGTGTGCTGCAGTGGGGAGG + Intronic
961682775 3:128610099-128610121 AGATCTGTGCCGCAGTGGGGTGG - Intergenic
962971585 3:140406611-140406633 ACATGTGTGCCTCTGTGGTGGGG - Intronic
963586535 3:147197239-147197261 ACATGTGTGATACTGTAGGGAGG - Intergenic
966255958 3:177917329-177917351 ACATACGGGCTGCAGTGGGGAGG + Intergenic
967138050 3:186529176-186529198 AGAAATGTGCTGCAGTGGGGAGG + Intergenic
967920073 3:194607923-194607945 ACTTGTGGGCTTCAGTGGGAGGG + Intronic
969346197 4:6571671-6571693 ACAGCTGTGATACAGTGGGCAGG + Intergenic
981489448 4:145324288-145324310 ATATGTGTTCTAGGGTGGGGAGG - Intergenic
982678110 4:158399482-158399504 TCATGTCTGCTCCAGTGGGACGG + Intronic
984131256 4:175878367-175878389 AGATGTCTGCTACAGGGGTGGGG - Intronic
984334284 4:178368938-178368960 ACATGTGTGCACCAATGGTGGGG - Intergenic
988073375 5:26324056-26324078 GCATGCCTGCTGCAGTGGGGTGG + Intergenic
988112645 5:26842828-26842850 AGATGAGTGATACAGTGAGGGGG - Intergenic
990178244 5:53131227-53131249 ACATGTCTGCATCATTGGGGAGG + Intergenic
991776496 5:70090389-70090411 ACAAGTGAGAGACAGTGGGGGGG - Intergenic
991855783 5:70965836-70965858 ACAAGTGAGAGACAGTGGGGGGG - Intergenic
991869798 5:71098614-71098636 ACAAGTGAGAGACAGTGGGGGGG - Intergenic
992459011 5:76943079-76943101 ATACATGTGCCACAGTGGGGGGG + Intergenic
995742531 5:115369571-115369593 ACATGTGGGCGGCAGTGGGGCGG - Intergenic
1000312250 5:160056239-160056261 ACATGTGTGCCAGAGTGGCCAGG - Intronic
1000448676 5:161357335-161357357 ACATGTGTGGTATATTGGAGAGG + Intronic
1001369650 5:171185799-171185821 ACATTTGTTATTCAGTGGGGAGG - Intronic
1002459535 5:179366180-179366202 ACATGTGAGCAACTGTGGAGGGG + Intergenic
1002926119 6:1606619-1606641 AACTGTGGGCTGCAGTGGGGAGG - Intergenic
1003632602 6:7801674-7801696 AGATGTGTGCCAAATTGGGGTGG + Intronic
1004954139 6:20708472-20708494 GAATGTGTGTTACAGTGTGGTGG + Intronic
1006409510 6:33864273-33864295 AAATGTGTGCTTGAGTGGGTGGG + Intergenic
1008445108 6:51579922-51579944 AAATGAGTGATACAGTGGAGAGG - Intergenic
1012866138 6:104620439-104620461 ACCTTTGTGCTAAAGTGGAGAGG - Intergenic
1014648309 6:124003721-124003743 ACATCAGAGCTACAGAGGGGAGG + Intronic
1016559348 6:145377875-145377897 AAATGTGTGCAACAAAGGGGTGG + Intergenic
1018049795 6:159998981-159999003 ATCTGTGTTCTACAGTGGGCAGG + Intronic
1020842781 7:13241366-13241388 ACTTCTCTGCAACAGTGGGGTGG - Intergenic
1021021973 7:15611968-15611990 TCATGTGTATTACAGTGGGCAGG - Exonic
1021103843 7:16614882-16614904 ACATGTGTGCTACAGTGATGAGG - Intronic
1022679042 7:32526906-32526928 AAATTTGTGCCGCAGTGGGGAGG - Intronic
1025006741 7:55361562-55361584 ACATGTGGTCTGCAGTGAGGTGG + Intergenic
1026221140 7:68398671-68398693 ACATGTGTGCTAGTGTGGCAGGG + Intergenic
1031151224 7:118056385-118056407 AGATGAGTGATACAATGGGGTGG + Intergenic
1032415040 7:131729332-131729354 GCATGTGTCCCACGGTGGGGCGG + Intergenic
1032797261 7:135288035-135288057 ACATGTGTGGTAAGGTAGGGTGG - Intergenic
1035777924 8:2203690-2203712 ACAGGTGTGCTACGCTGGGGCGG + Intergenic
1036674332 8:10817646-10817668 ACCTGTGTGCCACACTGAGGAGG - Intronic
1041872419 8:62649810-62649832 ACAGGTGTGCTGCATTGGGCAGG + Intronic
1049067954 8:140333878-140333900 ACATCTGTGTTACACTGGGAAGG - Intronic
1049787628 8:144458641-144458663 ACATGGGCGCTACAGGCGGGAGG + Intronic
1053562944 9:39214958-39214980 CCATGTGGTCTAAAGTGGGGAGG - Intronic
1055012678 9:71584263-71584285 ACATGTGTGCCACAGAGAGATGG + Intergenic
1056541930 9:87579136-87579158 AAATGTGTGCATCAGTGGGGAGG - Intronic
1058215804 9:102232059-102232081 ACAGGTGTGCGACAGGGGTGTGG + Intergenic
1060581191 9:124748435-124748457 AAATGGGGGCTACAGTGGGATGG - Intronic
1185492844 X:532035-532057 ACAAGTGGGGGACAGTGGGGTGG - Intergenic
1185493164 X:534590-534612 ATATGAGTGCTACTGTAGGGTGG - Intergenic
1188897049 X:35681584-35681606 ACATCTGTGCTACTGTGGAGAGG - Intergenic
1189338240 X:40184205-40184227 ACATGTGTGCTGCTTTGGTGGGG + Intergenic
1193211347 X:78810537-78810559 ACATGCCAGCTGCAGTGGGGTGG + Intergenic
1195976874 X:110536199-110536221 ACATGTGAGATACAGAGGGTGGG + Intergenic
1196497655 X:116340710-116340732 TCATGTGTGATACATGGGGGAGG - Intergenic
1197730681 X:129806769-129806791 ACATTTGTTCTGAAGTGGGGAGG - Intronic
1198054247 X:132977959-132977981 ACATCTGTCCTCAAGTGGGGAGG - Intergenic
1201266586 Y:12212771-12212793 ACATGTGTTCTACACAGGGCAGG - Intergenic
1201267079 Y:12217594-12217616 AAATGTGTGCTGCACAGGGGAGG - Intergenic
1201718282 Y:17070919-17070941 AAGTGTGTGCTACACAGGGGAGG + Intergenic