ID: 911064264

View in Genome Browser
Species Human (GRCh38)
Location 1:93773652-93773674
Sequence CTGGATTTCCACATGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911064261_911064264 -7 Left 911064261 1:93773636-93773658 CCTATAAAGTATAGGACTGGATT 0: 1
1: 0
2: 1
3: 6
4: 120
Right 911064264 1:93773652-93773674 CTGGATTTCCACATGGTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 197
911064255_911064264 29 Left 911064255 1:93773600-93773622 CCAGGTTCCAGTTGCACAATCAG 0: 1
1: 0
2: 0
3: 6
4: 141
Right 911064264 1:93773652-93773674 CTGGATTTCCACATGGTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 197
911064256_911064264 22 Left 911064256 1:93773607-93773629 CCAGTTGCACAATCAGCTAGTGC 0: 1
1: 0
2: 0
3: 16
4: 65
Right 911064264 1:93773652-93773674 CTGGATTTCCACATGGTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 197
911064259_911064264 -1 Left 911064259 1:93773630-93773652 CCAGTGCCTATAAAGTATAGGAC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 911064264 1:93773652-93773674 CTGGATTTCCACATGGTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 197
911064258_911064264 0 Left 911064258 1:93773629-93773651 CCCAGTGCCTATAAAGTATAGGA No data
Right 911064264 1:93773652-93773674 CTGGATTTCCACATGGTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911064264 Original CRISPR CTGGATTTCCACATGGTGCT GGG Intronic
900314311 1:2049586-2049608 CTGGGTGTCCACCTGGTGCCTGG + Intergenic
900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG + Intronic
900565336 1:3329241-3329263 GTGGCGTTCCAGATGGTGCTAGG + Intronic
905027533 1:34861061-34861083 CTGGGTTTCACCATGTTGCTAGG + Intergenic
905833432 1:41094257-41094279 CTTGATTGCCACATGTTGCAGGG - Intronic
906731824 1:48089506-48089528 CTGGAGTTCCAGCTGGTGCCCGG + Intergenic
907643864 1:56221078-56221100 CTGCATTTTCACAAGGTCCTGGG + Intergenic
907855326 1:58297867-58297889 CTGCATTTGGACAAGGTGCTTGG + Intronic
908816882 1:68043761-68043783 GTGGATTTCCAGAAGGTTCTTGG - Intergenic
908845815 1:68323205-68323227 CTGGACTTCCAGATGTTGCAAGG - Intergenic
908913965 1:69104532-69104554 CTGAATTTCCAAATGCGGCTAGG + Intergenic
909699035 1:78499826-78499848 CTGTTATTCCAAATGGTGCTTGG + Intronic
910713460 1:90205205-90205227 ATGGACTTCAACATGGTGCTGGG + Intergenic
911064264 1:93773652-93773674 CTGGATTTCCACATGGTGCTGGG + Intronic
912964222 1:114223381-114223403 CTGGTTTTCCTCATGGCACTTGG + Intergenic
913111899 1:115664444-115664466 CTGGACTTCTAGATGGTGCGGGG + Intronic
913416343 1:118612913-118612935 GTGTATATCCAAATGGTGCTAGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914509459 1:148318234-148318256 CAGGATTTCGACATGTTGCCGGG + Intergenic
915021143 1:152779496-152779518 CTGGATCTTCTCATGTTGCTTGG - Intronic
915043091 1:152984837-152984859 CAGGCTTTCTACATGGTACTAGG + Intergenic
915658076 1:157377914-157377936 CTGGATTTCCACATGCAGAAGGG + Intergenic
916745498 1:167681959-167681981 CCAGATTTCCCCATGATGCTGGG - Intronic
917170552 1:172168508-172168530 CCAGATTACCACAGGGTGCTTGG + Intronic
919644541 1:200081118-200081140 CTGTTTTTCCACTTGTTGCTTGG + Intronic
922194852 1:223351196-223351218 CCGGATTGCCACATGGTGACAGG + Intronic
922419292 1:225448714-225448736 CTGGATGTCCTCATGGTGCCTGG + Intergenic
922703007 1:227772792-227772814 CTGGTTTACCAGATGGTGTTGGG - Intronic
922885473 1:229017115-229017137 CTGGATTGCCACAGGGGTCTTGG + Intergenic
1063079468 10:2751774-2751796 CTTGATTTCCAGATGGTGAATGG - Intergenic
1065452095 10:25869952-25869974 CTGGCATTCCACAAGGTGCTGGG - Intergenic
1066558697 10:36644478-36644500 TTGGATTTCAAAATGGTGATAGG - Intergenic
1068757562 10:60671658-60671680 CTGCATTTCCACAGTGTCCTGGG - Intronic
1069708355 10:70473378-70473400 GAGCATTTCCACATGGAGCTTGG + Intergenic
1069714635 10:70512782-70512804 CTGGACTTCCACACTGTACTTGG - Intronic
1070492704 10:76992631-76992653 CTGGGTTCCCTCATGGTGGTAGG - Intronic
1072141958 10:92596952-92596974 CTGGACTTCTGTATGGTGCTGGG - Intronic
1074718269 10:116240743-116240765 CTGGCATTCCACACAGTGCTTGG + Intronic
1075285235 10:121179079-121179101 CATGAGTTCCAAATGGTGCTAGG - Intergenic
1075386679 10:122060233-122060255 TTGGATTTCCTTCTGGTGCTGGG + Intronic
1076514111 10:131033556-131033578 TTGGCTTTGCACATGGCGCTGGG + Intergenic
1076832289 10:133001873-133001895 CTGGAATTGCATGTGGTGCTGGG + Intergenic
1076911556 10:133392575-133392597 CTGCATTCCCTCATGGTCCTAGG - Intronic
1078090223 11:8260374-8260396 CGGGCTTTCTACATGCTGCTGGG - Intronic
1079270728 11:18983286-18983308 CTGCATTTCCAGATGTTCCTGGG - Intergenic
1079800121 11:24858882-24858904 CTGGATTTCAAAATGGAGGTGGG - Intronic
1081583190 11:44366379-44366401 CTGGATTTCCTCATTCTGTTTGG - Intergenic
1081583197 11:44366437-44366459 CTGGATTTCCTCATTCTGTTTGG - Intergenic
1082833267 11:57635030-57635052 CTGGATTTCCACATGTCAATTGG + Intergenic
1082912358 11:58390913-58390935 CTGGAGCTGCACATGGTCCTTGG - Intergenic
1084243273 11:67837338-67837360 CTGCATTTCAACAAGGTCCTTGG + Intergenic
1085155209 11:74287057-74287079 CTGGATTCCCACAGGGCCCTTGG + Intronic
1085250445 11:75140249-75140271 CTGGACTTCCCCATGGTCCCAGG - Intronic
1087030618 11:93700622-93700644 CAGGGTTTCCCCATGTTGCTGGG + Intronic
1087686599 11:101272560-101272582 CTGGCCTTCCACCTGGTGCCAGG - Intergenic
1088830230 11:113530538-113530560 CTGAATTTCTGCATGGGGCTGGG - Intergenic
1090613283 11:128491037-128491059 GGGGCTTTCCACATTGTGCTAGG + Intronic
1090707772 11:129354807-129354829 CTGGACTTCTACATGGTGGCTGG + Intergenic
1092413527 12:8272076-8272098 CTGCATTTCAACAAGGTCCTCGG + Intergenic
1092868159 12:12782451-12782473 CTGAATTTCCTCATGGTTCGAGG + Intronic
1093616307 12:21229888-21229910 CTGTTTTTCAACATGGTACTGGG - Intronic
1093779609 12:23120484-23120506 CTGAATTCCCACAAGGAGCTGGG - Intergenic
1096565188 12:52472360-52472382 TTGGAGGTCCCCATGGTGCTGGG + Intronic
1097133015 12:56827499-56827521 CAGGAGAACCACATGGTGCTGGG + Intergenic
1098670735 12:73227255-73227277 CTGGATTCACACATGCTGCTAGG + Intergenic
1099391129 12:82079658-82079680 GTGGATTTCCACATTCTTCTTGG + Intergenic
1103145732 12:118594340-118594362 CCAGATTTCAACATGGTGTTGGG + Intergenic
1103238442 12:119394432-119394454 CTGGACTACCACATGGTGGGTGG - Intronic
1106650055 13:31680780-31680802 CTGGAATTACATATGGTTCTTGG - Intergenic
1107098123 13:36558773-36558795 CTGGATTTACACATGGAAATGGG + Intergenic
1109263996 13:60175625-60175647 CTGGATCCCCACATGGTGGAGGG - Intergenic
1109673212 13:65637462-65637484 CTTGAGTTCCATATGGTTCTGGG - Intergenic
1110648236 13:77914707-77914729 CTGGACTTCCTCAAGGAGCTGGG - Intronic
1111947375 13:94679960-94679982 ATACATTTCCACATTGTGCTCGG + Intergenic
1112296689 13:98193722-98193744 CTGGATTTCCACAAGGCATTTGG - Intronic
1114469187 14:22947489-22947511 CTGGATACCCACAAGGCGCTAGG + Intronic
1118240218 14:64049119-64049141 CTGGATTTTAACATGATTCTTGG + Intronic
1119493604 14:75059305-75059327 CTGGGTTTCCCCATGTTGCCTGG - Intronic
1121312615 14:92943421-92943443 CTTGAATACCACATGGTGCCAGG + Intronic
1122094907 14:99363668-99363690 CTGGAAGTCCACATCTTGCTAGG + Intergenic
1127391654 15:58510108-58510130 CTGAATGCCAACATGGTGCTAGG + Intronic
1130155903 15:81349662-81349684 GTGGCTTTCCACAGGGTCCTTGG + Intronic
1130690582 15:86078504-86078526 CTGCATTTCCAGATCCTGCTTGG - Intergenic
1133420247 16:5640001-5640023 CTGATTTTCCCCGTGGTGCTGGG + Intergenic
1134741579 16:16551640-16551662 GTAGATTTCCACATGGGGATAGG - Intergenic
1134925983 16:18160790-18160812 GTAGATTTCCACATGGGGATAGG + Intergenic
1135231164 16:20709145-20709167 CTGGATATCCACATGCTGAATGG + Intronic
1136181467 16:28555271-28555293 CTGGATTTCACCACGTTGCTCGG - Intronic
1137409988 16:48220237-48220259 CTGAATTTGGACATGGTGCCTGG - Intronic
1137618533 16:49860378-49860400 CAGGGTTTCAACATGTTGCTGGG - Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1143323238 17:6081270-6081292 CTGGAGTTCCACATGGCTCAAGG + Intronic
1148476207 17:47930404-47930426 CTTCATTTCCAAATGATGCTGGG - Intergenic
1148684153 17:49491389-49491411 GTGCAATTCCACATGGAGCTGGG - Intergenic
1148996360 17:51713706-51713728 CTGCATTTCCATATGGCCCTGGG + Intronic
1150283226 17:63941270-63941292 CTGGACTTGCCCATGGTGCCAGG - Exonic
1151310297 17:73288648-73288670 CTGGACTTCCAGTGGGTGCTTGG - Intronic
1154948528 18:21185495-21185517 CTGGACTTCCAGGAGGTGCTAGG - Intergenic
1155771999 18:29713106-29713128 CTAGATTTCCCCATGATGCCAGG - Intergenic
1156877363 18:42031105-42031127 CTGCATTTCTTCATGGTGCCAGG - Intronic
1158641959 18:59211572-59211594 CTGCATTTCCACTAGGTGTTGGG - Intergenic
1158857489 18:61557699-61557721 CAGTATTTCCATATAGTGCTGGG + Intergenic
1162002950 19:7759411-7759433 CAGGATTTCCGCTTGGTTCTTGG + Intergenic
1166341866 19:42142752-42142774 CAGGATTTCAACATGTTGCATGG + Intronic
1167416356 19:49375077-49375099 CTTTATTTCCATATGGTGCTTGG - Exonic
1167697228 19:51022493-51022515 CTCCATTTCCACTTGGTGTTTGG - Exonic
1168112103 19:54198731-54198753 TTGGCCTTCCACATAGTGCTGGG + Intergenic
925098483 2:1226431-1226453 CTGTATTCCCAGTTGGTGCTGGG - Intronic
925811066 2:7701371-7701393 CTGGATCTCCACCATGTGCTCGG - Intergenic
926721423 2:15964191-15964213 CTAGATTTAAACATGGTGCCAGG + Intergenic
927657094 2:24958398-24958420 CTGGCTTCCCCCAGGGTGCTAGG + Intronic
927897180 2:26790659-26790681 CTGGATTGCCAACTGGTGGTGGG + Intronic
928341319 2:30445697-30445719 CAGGATTTCAACATGTTGCCAGG - Intergenic
929617110 2:43319976-43319998 CTGACTTTCCACATGTTTCTTGG - Intronic
929889838 2:45909895-45909917 CTCTAGTTCCACATGCTGCTTGG + Intronic
929963235 2:46512214-46512236 CTGGACCTCCACATGTTTCTGGG + Exonic
930942355 2:57028123-57028145 CTGGATTCTCCCTTGGTGCTGGG - Intergenic
931509832 2:62979085-62979107 CTGGTTTACAGCATGGTGCTTGG - Intronic
932782441 2:74569211-74569233 CATGATTTCCACATAGTGGTTGG - Intronic
933899356 2:86837948-86837970 CTGGAAGTTCACATGGGGCTGGG - Intronic
935675897 2:105594902-105594924 CCAGATTGCCACCTGGTGCTGGG - Intergenic
935781206 2:106511280-106511302 CTGGAAGTTCACATGGGGCTGGG + Intergenic
936059739 2:109286589-109286611 CTGGATTGGCACATGGTGAGGGG + Intronic
938164885 2:129017769-129017791 CTGGATTCCCTCATGGTCCAAGG + Intergenic
938290159 2:130144769-130144791 CTCGATCTCCTCATGGAGCTTGG + Exonic
938466370 2:131528176-131528198 CTCGATCTCCTCATGGAGCTTGG - Exonic
939452625 2:142393739-142393761 CTGCATTTCCAGCTGGTGGTTGG - Intergenic
944016488 2:195045471-195045493 CTGTATTTTCAAATGGTCCTTGG - Intergenic
945339196 2:208631438-208631460 CTGGAATTTCACATGGTGAGAGG - Intronic
948698195 2:239744340-239744362 GTGGAGATCCACATGGGGCTTGG - Intergenic
948979203 2:241484354-241484376 TGGGATTTCCACGTGGTGCTGGG + Intronic
1169135730 20:3195939-3195961 CTGGATTTCCTCCTGCTCCTTGG + Intronic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1171277201 20:23867476-23867498 CTGGGTGCTCACATGGTGCTGGG - Intergenic
1171935983 20:31274916-31274938 CTTTATTTCCATATGCTGCTTGG - Intergenic
1174745752 20:53060490-53060512 CTGGTTTTCTACACGGTGCTAGG + Intronic
1175302740 20:57954345-57954367 CTGGATGTCTACTGGGTGCTAGG + Intergenic
1176707915 21:10128722-10128744 CTGGATATCCACCTGGGGCTTGG + Intergenic
1177688951 21:24478167-24478189 CTGCAATGCCAGATGGTGCTTGG - Intergenic
1179829480 21:43987646-43987668 CTGGGTGTCCACATGCTCCTGGG + Intergenic
1184231253 22:43159530-43159552 CTGGCTTGCCAAATGGGGCTGGG - Intronic
1184457287 22:44618445-44618467 CTGGACCTCCCCAGGGTGCTGGG - Intergenic
950222370 3:11206081-11206103 ATGGATTGCCACCTGGTGGTTGG + Intronic
950995477 3:17491906-17491928 CTGGAAATCCACCTGGTCCTGGG + Intronic
951019896 3:17771311-17771333 CTGGTTTTCCCCATGGTCTTTGG + Intronic
951347462 3:21563199-21563221 CTGTATTTTCACATGGTGGAAGG - Intronic
959626955 3:108463522-108463544 TTTGGTTTCCACATGTTGCTCGG + Intronic
961891081 3:130130727-130130749 CTGCATTTCAACAAGGTCCTCGG + Intergenic
964562476 3:158012903-158012925 CTGGCTTTCCAGATGGTTCAGGG - Intergenic
965272606 3:166638314-166638336 CTGGACTTCCACCTGCTGCTGGG - Intergenic
966060859 3:175753445-175753467 TTGAATTTCAACACGGTGCTGGG + Intronic
969002470 4:3993151-3993173 CTGCATTTCAACAAGGTCCTCGG + Intergenic
969723034 4:8903835-8903857 CTGGATTTGAACAGGGTCCTTGG - Intergenic
973152095 4:46900741-46900763 CTGTATTCTCACATGGTGGTAGG - Intronic
974988325 4:69056957-69056979 CTGGTTTTGGGCATGGTGCTGGG - Intronic
975961663 4:79916003-79916025 CTGAATATCCATATGGTGCGTGG - Intronic
977435446 4:96989293-96989315 CACGCCTTCCACATGGTGCTTGG + Intergenic
978421159 4:108534143-108534165 ATGGATTTCCACAAGTGGCTGGG + Intergenic
982135620 4:152271802-152271824 CTTGATTTACAGATGCTGCTGGG + Intergenic
982156097 4:152522512-152522534 CTGGGTTTCCCAATGTTGCTTGG + Intronic
984901998 4:184593652-184593674 TGGGATCACCACATGGTGCTGGG - Intergenic
986228620 5:5840934-5840956 TTGGCATTCCTCATGGTGCTGGG - Intergenic
989712257 5:44413510-44413532 CAGGATGTCCACATGCTTCTAGG - Intergenic
993160858 5:84289121-84289143 CTAGATTTCTAAATGGAGCTGGG + Intronic
996191948 5:120555487-120555509 CTGTATTCTCACATGGTGGTGGG + Intronic
996352455 5:122560615-122560637 CTGGAGCCCCACATGGTGCAGGG - Intergenic
997609189 5:135200947-135200969 CTAGATTTCCACATGTAGTTGGG + Intronic
999287133 5:150400836-150400858 CTGGTGTTCCACATGGCTCTGGG - Intergenic
999720337 5:154394700-154394722 CTGGATATCCTTCTGGTGCTTGG - Intronic
1000108064 5:158079598-158079620 CTGGATTTCTCCATGAAGCTTGG - Intergenic
1001647747 5:173294923-173294945 CAGGATTTGCTCCTGGTGCTGGG + Intergenic
1001713938 5:173799474-173799496 TGGGCATTCCACATGGTGCTGGG - Intergenic
1007317283 6:40999645-40999667 CTGCCTTTCCACAGTGTGCTGGG - Intergenic
1009927608 6:70139029-70139051 CTTAATTTCCACATGATGCATGG + Intronic
1011412327 6:87078773-87078795 GTGGATGTCCATATGGGGCTTGG + Intergenic
1013905784 6:115217275-115217297 CTTGTTTTCAACATGGTACTGGG + Intergenic
1015563179 6:134538191-134538213 CAGGCTATCCACATGGTGCTTGG - Intergenic
1015860742 6:137676861-137676883 CTAGATTTCCATATGTTGTTGGG - Intergenic
1016199730 6:141394038-141394060 CTTGCTTTGCACATGGAGCTGGG + Intergenic
1016428650 6:143960003-143960025 CTGGATTGCCTCATGTGGCTGGG + Intronic
1017603142 6:156105093-156105115 CTGGAGGTCCACAGGGTGTTAGG + Intergenic
1019017854 6:168892698-168892720 CAGGTTTTCCACCTGGTCCTTGG + Intergenic
1019792914 7:3028991-3029013 CTGGGTTTCCACAGGCTGCAGGG + Intronic
1026658995 7:72282561-72282583 CTGCATTTTCACATGGTGGAAGG - Intronic
1028928629 7:96388355-96388377 CTGGATTTCAACAAAGTGTTTGG - Intergenic
1032084467 7:128876825-128876847 GTGTATTTCCTCCTGGTGCTGGG - Intronic
1032236677 7:130130392-130130414 CTTGATCTCCACATGGTATTGGG + Intronic
1032931411 7:136677127-136677149 GTGAATTTCCACATGCTGCTTGG - Intergenic
1033500276 7:141941544-141941566 CTGTTTTTCAACATAGTGCTGGG + Intronic
1035355058 7:158271530-158271552 CTGGATTGCCCCATGGGGCTTGG - Intronic
1036295978 8:7537527-7537549 CTGCATTTCCACATTGTGAGGGG + Intergenic
1036326588 8:7783492-7783514 CTGCATTTCCACATTGTGAGGGG - Intergenic
1038975938 8:32696072-32696094 CTTCATTTCCACCTGGGGCTGGG - Intronic
1041290551 8:56304261-56304283 ATGGAATTGCACATGGAGCTGGG + Intronic
1043530382 8:81143454-81143476 CTGGATCTTCACATGGTGAAAGG - Intergenic
1044929144 8:97235087-97235109 CTGGAATTCCACATGGGGTGAGG - Intergenic
1048814837 8:138322788-138322810 CTGGGATTCCAGATGGTGCCAGG - Intronic
1052356924 9:27514438-27514460 CTGGATTTCCACATTGTCAGAGG - Intronic
1053760872 9:41349394-41349416 CTGGATATCCACCTGGGGCTTGG - Intergenic
1055527076 9:77145780-77145802 CAGGCTTTCCACATGGGGCATGG + Intergenic
1056958989 9:91105231-91105253 CAGGATTTCCACTTGCTTCTTGG - Intergenic
1061352085 9:130073554-130073576 CTGGATTTCCACTTCCTGGTGGG - Intronic
1061951364 9:133938184-133938206 ATGGATTTCCACCTGCTGATGGG - Intronic
1062679145 9:137767620-137767642 CTGGATTTCCCCATGTTGGCCGG - Intronic
1202792660 9_KI270719v1_random:97602-97624 CTGGATATCCACCTGGGGCTTGG + Intergenic
1186110721 X:6253055-6253077 CAGTATTTCAACTTGGTGCTGGG - Intergenic
1186141374 X:6578017-6578039 CTAGATTTTCTCATGTTGCTTGG - Intergenic
1187383895 X:18830177-18830199 CTGGAACTCCAAATGGTCCTTGG - Intergenic
1187734387 X:22289543-22289565 CAAGCTTTCCACATGGTGTTGGG + Intergenic
1192329852 X:70166496-70166518 CTGGATTGCTTCATGGTGCAGGG - Intergenic
1198028857 X:132735655-132735677 CTGGATGCCCACATGGAGCTGGG + Intronic
1199175101 X:144778213-144778235 GTGGATATCCACATGGTATTGGG - Intergenic
1199408647 X:147493586-147493608 CTGTATTACCACAGGATGCTTGG - Intergenic