ID: 911064596

View in Genome Browser
Species Human (GRCh38)
Location 1:93776938-93776960
Sequence GGGTTCTTACAGATGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911064590_911064596 5 Left 911064590 1:93776910-93776932 CCTGTGATCGTGACCTCATTTGG 0: 1
1: 3
2: 29
3: 339
4: 946
Right 911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG 0: 1
1: 0
2: 1
3: 11
4: 118
911064588_911064596 19 Left 911064588 1:93776896-93776918 CCACCAACGCTGTGCCTGTGATC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG 0: 1
1: 0
2: 1
3: 11
4: 118
911064587_911064596 20 Left 911064587 1:93776895-93776917 CCCACCAACGCTGTGCCTGTGAT 0: 1
1: 0
2: 0
3: 9
4: 81
Right 911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG 0: 1
1: 0
2: 1
3: 11
4: 118
911064589_911064596 16 Left 911064589 1:93776899-93776921 CCAACGCTGTGCCTGTGATCGTG 0: 1
1: 0
2: 1
3: 70
4: 1308
Right 911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG 0: 1
1: 0
2: 1
3: 11
4: 118
911064594_911064596 -8 Left 911064594 1:93776923-93776945 CCTCATTTGGAAACAGGGTTCTT No data
Right 911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG 0: 1
1: 0
2: 1
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911064596 Original CRISPR GGGTTCTTACAGATGGAATC AGG Intronic
904489355 1:30848751-30848773 GGGTCTTTGCAGATGTAATCAGG - Intergenic
908661384 1:66439238-66439260 TGGGTTTTACAGTTGGAATCAGG + Intergenic
911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG + Intronic
918060871 1:181060296-181060318 GGGTTGTTGCAGATGTAATTTGG - Exonic
918250143 1:182696154-182696176 GGGTTCTTACAGAGGGATAGAGG - Intergenic
918451709 1:184664871-184664893 GGGTGCTTACAGCTGGGGTCAGG + Intergenic
919516727 1:198534176-198534198 GGGTCTTTGCAGATGTAATCAGG + Intronic
920898870 1:210086890-210086912 GGTTTCTTACTGATGGAAAAGGG - Intronic
1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG + Intergenic
1068514416 10:58008356-58008378 GGGCTCTTGCAGATGTAATTAGG + Intergenic
1072469028 10:95694308-95694330 GGTTTCTCACCGTTGGAATCCGG - Intergenic
1074890625 10:117733927-117733949 GGGTTCTTACAGTTAGTAACTGG + Intergenic
1075849368 10:125574669-125574691 GGATTCCTACAGATTGATTCGGG + Intergenic
1075978352 10:126716343-126716365 GTGTTCTTACCAATGGAATGTGG + Intergenic
1076136186 10:128046862-128046884 GGCCTCTGACAGGTGGAATCGGG + Intronic
1078487320 11:11735724-11735746 GGATTCATTCACATGGAATCAGG - Intergenic
1078492543 11:11782880-11782902 GGCTTCACACACATGGAATCAGG + Intergenic
1091016004 11:132051373-132051395 GGGTTCAGAATGATGGAATCTGG + Intronic
1091539907 12:1450376-1450398 GGTTTCGTATAAATGGAATCAGG + Intronic
1091753561 12:3037662-3037684 GAAATCTTAAAGATGGAATCTGG + Intronic
1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG + Intronic
1102889039 12:116543865-116543887 GGGTTTTTGCAGATGTAATTAGG - Intergenic
1109149107 13:58822754-58822776 CAGTTCTTAAAGATGGTATCTGG + Intergenic
1111231985 13:85355255-85355277 GGTTTCTTAAAGATGGCATACGG - Intergenic
1111966622 13:94867913-94867935 GGGTTCTTAGAAATAGATTCAGG + Intergenic
1112378736 13:98868450-98868472 GGGTTTTTTAAGATGGACTCAGG - Intronic
1116402250 14:44522199-44522221 GGGTCTTTACAGATGTAATTAGG + Intergenic
1117532789 14:56675578-56675600 AGGTTCCTACAGATGGTATATGG - Intronic
1121004745 14:90483006-90483028 GGGTTCATACAGTTGTGATCTGG + Intergenic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1124636520 15:31368109-31368131 GGGTCTTTGCAGATGTAATCAGG - Intronic
1126439952 15:48676575-48676597 AGATTCTTAGACATGGAATCTGG + Intergenic
1135169426 16:20170123-20170145 GGGTCCTTGCAGATGTAATGAGG - Intergenic
1138687337 16:58737053-58737075 GGGTCTTTACAGATGTAATCAGG - Intergenic
1139577986 16:67854478-67854500 GGGGGCTTACAGAGGGAAACAGG + Intronic
1140644770 16:77017716-77017738 GGGTCTTTGCAGATGTAATCAGG + Intergenic
1141675219 16:85514111-85514133 GGGTTCTTCCAGAAGGAGGCAGG - Intergenic
1141731363 16:85825175-85825197 GGGTCTTTGCAGATGTAATCAGG - Intergenic
1146257779 17:31401518-31401540 AGGTCCTTACAGCTGGAATCTGG - Intronic
1146769235 17:35553396-35553418 AGCTTCTTACAGAGGGATTCTGG + Exonic
1148823600 17:50376065-50376087 GTGCTCTTACAGATGGAAGGTGG + Exonic
1151004255 17:70415451-70415473 GGGTTCTTACAGGTGCCATGAGG + Intergenic
1157375207 18:47157445-47157467 CGGTTCTTACAGATCGAATAAGG + Exonic
1157451316 18:47791312-47791334 GGGTCATTGCAGATGGAATTAGG - Intergenic
1159378277 18:67622570-67622592 GGGTTCTCATAGATAGAATAAGG - Intergenic
1160548389 18:79677633-79677655 GTGTCCTTACAGTTGGAACCAGG + Intergenic
1167340021 19:48909912-48909934 AGGTCTTTACAGAGGGAATCAGG - Intronic
1167767389 19:51492547-51492569 GGGGCTTTACAGATGGAATTAGG + Intronic
1168650677 19:58090166-58090188 GGGTTCTTCCTGCTGGACTCCGG + Exonic
925867660 2:8243299-8243321 GGGTCTTTGCAGATGTAATCAGG + Intergenic
927691005 2:25208154-25208176 GGGTCTTTGCAGATGTAATCAGG + Intergenic
929568010 2:43001784-43001806 GGGCTCTTACAAGTGGATTCAGG + Intergenic
929735160 2:44540265-44540287 GGGTTCTCACAGACAAAATCTGG - Intronic
934617895 2:95786361-95786383 GGGTACTTACTGACAGAATCTGG - Intergenic
934642998 2:96038198-96038220 GGGTACTTACTGACAGAATCTGG + Intronic
935468195 2:103424918-103424940 GGGTCTTTACAGAGGAAATCAGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937378817 2:121357046-121357068 GGGTTTTTAGAGATGGATACCGG - Intronic
938916971 2:135951615-135951637 GTGTTCTCACTGATGAAATCTGG - Intronic
939962624 2:148578849-148578871 GGGTCTTTACAGAGGTAATCAGG + Intergenic
942432835 2:175933001-175933023 TTTTTCTTACAGATGGAATTAGG - Intronic
945111863 2:206367634-206367656 GGGTGTGTACAGATGGAATTTGG - Intergenic
946933943 2:224700154-224700176 GAACTCTTACAGAAGGAATCAGG + Intergenic
947442631 2:230136583-230136605 GGGTTCTGACAAATGGAATGGGG + Intergenic
1168832976 20:857259-857281 GAGTTCATGCAAATGGAATCTGG + Intronic
1168988079 20:2068025-2068047 GGCTTCTTGCAGGTGGAATGGGG + Intergenic
1169447889 20:5687711-5687733 GGGTCCCTGCAGATGCAATCAGG - Intergenic
1169928421 20:10807024-10807046 GGCTTGTGACAGATGGAACCAGG + Intergenic
1170398194 20:15951000-15951022 GAGTTCTTCCAGATGGGATGTGG - Intronic
1171970927 20:31564647-31564669 GAGTTCTTTCACATGGAGTCAGG - Intronic
1172202747 20:33138420-33138442 GGATTCTCACAGATGGAGTAGGG - Intergenic
1173092277 20:39984640-39984662 TGGTTATTTCAGAGGGAATCTGG - Intergenic
1176916566 21:14632906-14632928 GGTCTCTTCCACATGGAATCTGG + Intronic
1179589437 21:42396694-42396716 GGCTTCTGAAAGATGGAACCTGG + Exonic
1180128669 21:45809927-45809949 GGGGTTTTGCAGATGGTATCAGG + Intronic
1183704334 22:39467741-39467763 CGTTTCTTTCAGATGGAGTCTGG + Intronic
1184120487 22:42446566-42446588 GGGTCTTTTCAGATGTAATCAGG + Intergenic
949236080 3:1810151-1810173 GGGTTCTTATAGATGGATATAGG + Intergenic
955162362 3:56476667-56476689 GGGTCCTTAGCAATGGAATCAGG - Intergenic
956552302 3:70474909-70474931 GGGTCTTTGCAGATGTAATCTGG - Intergenic
959270341 3:104200149-104200171 GGGTTCTAACAGCTGGAAAAGGG + Intergenic
968284945 3:197503000-197503022 GGGTTTTGACAGATAGAAACAGG - Intergenic
969336733 4:6515035-6515057 GGGTCTTTGCAGATGTAATCAGG - Intronic
969528129 4:7714515-7714537 TGGTTCTAACAGATGGAATGAGG - Intronic
969844913 4:9912887-9912909 GGGTCCTTAAAGAGGGAGTCAGG + Intronic
974306142 4:60142751-60142773 GAGTCCATACAGATGGAACCTGG + Intergenic
979683472 4:123485862-123485884 GGCTTTATAAAGATGGAATCAGG - Intergenic
984195143 4:176650136-176650158 GTGTTCTTGCAGATGTAATTAGG - Intergenic
984731634 4:183073909-183073931 GGAATCTTACTGATGGAATTTGG + Intergenic
985999160 5:3616602-3616624 GAGTTCTTAGGGATGGAGTCAGG - Intergenic
987142613 5:14960904-14960926 GGATACTGAAAGATGGAATCAGG + Intergenic
990348457 5:54891805-54891827 GGGTTCTTTCTGATGGAGACTGG + Intergenic
997389585 5:133503189-133503211 GGGTTCTTTCCCTTGGAATCTGG - Intronic
1000333290 5:160222986-160223008 GGTTTTTTAGAGATGGGATCTGG + Intronic
1001154702 5:169262968-169262990 GGGTCTTTGCAGATGTAATCAGG + Intronic
1003143394 6:3490140-3490162 GGGTCTTTACAGAGGTAATCAGG + Intergenic
1005799340 6:29404577-29404599 GAGTTCTTAGACACGGAATCTGG + Intronic
1006875861 6:37295646-37295668 AGGTTCTTACAGATCAAATAAGG + Intronic
1011931673 6:92722734-92722756 GGGTTCTTACAAATGGAGGAGGG - Intergenic
1013160129 6:107535217-107535239 GTGTTTTTCCAAATGGAATCAGG - Intronic
1014409070 6:121091818-121091840 GGGTCTTTACAGACGTAATCAGG + Intronic
1014756307 6:125305047-125305069 GGGTTCTTAAAGATGGAAAAGGG + Intergenic
1030520486 7:110591687-110591709 AGCTTCTTACAGACAGAATCTGG + Intergenic
1030957978 7:115878813-115878835 GGGTTCTTACAAAGAGAAACAGG + Intergenic
1033132062 7:138753146-138753168 GGGTCTTTGCAGATGGAATCAGG + Intronic
1033522300 7:142173342-142173364 GGTTTCATACATAGGGAATCTGG - Intronic
1033992546 7:147306066-147306088 GGGTTCTTACAGATACAATCAGG - Intronic
1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG + Intronic
1037597130 8:20363603-20363625 GGGTCCTTGCAGATGTAATCGGG + Intergenic
1039635404 8:39159321-39159343 TGGTTTTTACAGATTGACTCTGG + Intronic
1039864183 8:41487011-41487033 GGGTCTTTACAGATGTAATCAGG + Intergenic
1040465726 8:47693362-47693384 GGTTTCTTACAGAAGAAATCAGG + Intronic
1049317397 8:141976628-141976650 GGGTTTTTACATATGTAATTAGG + Intergenic
1051090265 9:13398957-13398979 GGGTTCTTTAAGATTGCATCCGG - Intergenic
1052159162 9:25234124-25234146 GGGTTCTTACAAATGAAGTAAGG - Intergenic
1053108850 9:35439087-35439109 GGGTTATTAAAGATGGAAGGAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053871814 9:42500996-42501018 GGGTTCTTTCAGAGGTAATTTGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1057287664 9:93773231-93773253 GTGATATTACAGATGGAATGAGG + Intergenic
1061936986 9:133863413-133863435 CGGGTCGTACAGATGGAACCGGG + Intronic
1185752381 X:2623441-2623463 AGGCTCTTACCGGTGGAATCAGG - Intergenic
1189743965 X:44150869-44150891 GGGTTTTTGCAGATGTAATTAGG + Intronic
1197822674 X:130557033-130557055 GGGTCATTACAGAGGTAATCAGG + Intergenic
1198274445 X:135087954-135087976 TGGTTGTTACAGATGGATTCTGG + Intergenic
1198314489 X:135452257-135452279 CAGTTGTTACAGATGGACTCTGG - Intergenic
1199159028 X:144586279-144586301 GCGTTCATCCAGATGGAAACAGG - Intergenic
1199981286 X:152921907-152921929 GGGTCTTTGCAGATGTAATCAGG - Intronic