ID: 911065163

View in Genome Browser
Species Human (GRCh38)
Location 1:93781578-93781600
Sequence GATGATGAAAACAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911065157_911065163 -7 Left 911065157 1:93781562-93781584 CCAGCCCTACTTTACAGATGATG No data
Right 911065163 1:93781578-93781600 GATGATGAAAACAGGGCTCTGGG 0: 1
1: 0
2: 1
3: 31
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911065163 Original CRISPR GATGATGAAAACAGGGCTCT GGG Intronic
900268732 1:1775623-1775645 GATGAAGAAAACAGGGGTCTGGG + Intronic
902124782 1:14199610-14199632 GTTGTTGAAAGAAGGGCTCTGGG + Intergenic
902553178 1:17231263-17231285 GATGAGGAAATCAAGGCTCAGGG + Intronic
902954557 1:19916252-19916274 CATGATGAAAATCAGGCTCTGGG + Intergenic
903073184 1:20738941-20738963 GATGAGGAAATCAAGGCTCAGGG + Intergenic
904959232 1:34318123-34318145 GATGAAGGAAACAGGCTTCTTGG - Intergenic
907714633 1:56915695-56915717 GATGAGGAAAACAGGGCAGAAGG + Intronic
907766767 1:57420764-57420786 GATGATGAAAGCAAGGTTCTGGG + Intronic
908617397 1:65937466-65937488 GATCTTTAAAACAGGGCTTTAGG - Intronic
908679989 1:66649919-66649941 GATGAAGAAACCAAGGCACTGGG - Intronic
908743432 1:67352342-67352364 CATGATGCCATCAGGGCTCTAGG + Intronic
910327826 1:86030276-86030298 CATGCTGAAGACAGGGCCCTGGG + Intronic
911065163 1:93781578-93781600 GATGATGAAAACAGGGCTCTGGG + Intronic
912232744 1:107814758-107814780 TATGATGAAAACAGTGCTTATGG + Intronic
913609754 1:120499463-120499485 TATGATGAAAACAGAACTTTAGG - Intergenic
914204067 1:145511673-145511695 TATGATGAAAACAGAACTTTAGG + Intergenic
914247544 1:145897211-145897233 TAGGATGAAAAGAGGGCTCTAGG - Intronic
914483191 1:148084827-148084849 TATGATGAAAACAGAACTTTAGG + Intergenic
914581438 1:149022778-149022800 TATGATGAAAACAGAACTTTAGG + Intronic
915441282 1:155947020-155947042 GAAGATGAGGTCAGGGCTCTTGG + Exonic
916578868 1:166090138-166090160 GAAGAAGATTACAGGGCTCTGGG - Intronic
916926250 1:169524058-169524080 GATGATGAAATCTGGGCTTCAGG + Intronic
920225409 1:204434914-204434936 GCTGATCAAGACTGGGCTCTTGG - Intronic
922411377 1:225379004-225379026 GATGATGAAACCAGGGCCCCGGG - Intronic
923424132 1:233851740-233851762 GAGGATGAAGAAAGGGGTCTAGG - Intergenic
924596846 1:245453768-245453790 AATGATGAAATCAGGGCCCAAGG + Intronic
1063210400 10:3875634-3875656 GATGAGGAAACCAAGGCTCAGGG - Intergenic
1064430370 10:15265754-15265776 GATGATGAAGACACAGTTCTTGG + Intronic
1067073863 10:43161453-43161475 GCTGATCAAATCTGGGCTCTTGG - Intronic
1067121026 10:43472265-43472287 CATGATTAAAACTGGCCTCTTGG + Intronic
1067735039 10:48844214-48844236 GTTGATGTAAACTTGGCTCTTGG + Intronic
1068182252 10:53535618-53535640 GATGATGAACCCTGGACTCTTGG - Intergenic
1069799934 10:71075791-71075813 GATGAGGAAACCGAGGCTCTGGG + Intergenic
1070149467 10:73797087-73797109 GGTGAGGAAAACAGGACGCTGGG - Exonic
1070550137 10:77484547-77484569 GATGGGGAAATCAAGGCTCTGGG + Intronic
1071188624 10:83075007-83075029 GATGGTGGAAACAAGCCTCTAGG + Intergenic
1071241223 10:83707344-83707366 TATGATGAAATCTGGGCTGTTGG + Intergenic
1071415251 10:85435407-85435429 GATGGTGAAGAAAGGGCTTTCGG - Intergenic
1071461545 10:85901638-85901660 AATGATGAAAATATGGCTCAAGG + Intronic
1073291763 10:102416730-102416752 GAAGATGACCACAGAGCTCTGGG + Exonic
1074471968 10:113735518-113735540 GATGATGAAAACAGTTCCTTTGG - Intergenic
1075057984 10:119234082-119234104 GATGATGAAACCAAGGCTAATGG - Intronic
1075280753 10:121136229-121136251 GATGATGAACACAGGGCCTTGGG - Intergenic
1075288968 10:121212107-121212129 GAGGCTGAAAACACAGCTCTAGG - Intergenic
1075682649 10:124343553-124343575 GATGTTGATAGCAGGGCCCTTGG - Intergenic
1076156183 10:128207299-128207321 GATGATGAGAACAGTCCTCTTGG + Intergenic
1076352175 10:129824642-129824664 GACAATGAAAACAGTGTTCTGGG - Intergenic
1076426349 10:130370094-130370116 GATGATGAGGACATGGCTCTCGG + Intergenic
1077487176 11:2844366-2844388 GATGATGAGAGCATGTCTCTGGG + Intronic
1078236848 11:9492932-9492954 AATGATGACAACAGGCCTCATGG + Intronic
1079438665 11:20485379-20485401 GACAATAAAAACAGAGCTCTAGG + Intronic
1079661721 11:23045784-23045806 GATCATGAATATAGGGCTTTTGG + Intergenic
1080762234 11:35262810-35262832 GATGATGAAAATAGCTCTATTGG - Intronic
1082661537 11:55918084-55918106 GATGATGGTAACAAAGCTCTTGG - Intergenic
1083278396 11:61610648-61610670 GATGATAAGAGCAGGGCTGTTGG + Intergenic
1083642475 11:64152998-64153020 GATGAGGAAACCGGGGCTCAGGG + Intronic
1084153176 11:67300677-67300699 GAGGAGGAAAACGGGGCTGTGGG + Intronic
1084907407 11:72358717-72358739 TAGGAGGATAACAGGGCTCTGGG + Intronic
1085247247 11:75112628-75112650 AATGATAAAAGAAGGGCTCTTGG + Intronic
1085449164 11:76621766-76621788 GATGCAGAAACCAGGGCTCTAGG - Intergenic
1085499468 11:77006450-77006472 AATGATGAAAAAAGGGATCATGG - Intronic
1085762350 11:79252840-79252862 GCTGATCTAAACTGGGCTCTGGG - Intronic
1086756154 11:90565056-90565078 GATGATATAAAAAGGGATCTTGG - Intergenic
1089054870 11:115577407-115577429 AATGAAGAAAACAGCCCTCTTGG + Intergenic
1090613676 11:128495131-128495153 GATGAGGAAATCAAGGCCCTGGG + Intronic
1091238213 11:134035595-134035617 GATGGTGATACCAGGCCTCTGGG - Intergenic
1091240496 11:134049017-134049039 GATGATTAAGTCAGGGCACTTGG - Intergenic
1091416497 12:291496-291518 GATGATGCAACCAGGACTCAGGG - Intronic
1092920394 12:13226169-13226191 GGAGAGGAAAACTGGGCTCTAGG + Intergenic
1094582446 12:31746497-31746519 AGGGAAGAAAACAGGGCTCTAGG + Intergenic
1095857172 12:46873052-46873074 GATGATGAAACCAAGGCTGGGGG - Intergenic
1096527653 12:52221360-52221382 GATAAAGAAACCAGGGCTCAGGG + Intergenic
1099460173 12:82911397-82911419 GATGATGATAACAGAGTGCTGGG - Intronic
1099918741 12:88930583-88930605 GATGATGAAAGCAGGTTTTTAGG + Intergenic
1099975980 12:89545867-89545889 GGTGTTGAATACATGGCTCTGGG - Intergenic
1100155621 12:91796782-91796804 GATTGTGAAATCAGGACTCTAGG - Intergenic
1100283239 12:93138652-93138674 CATGATGAAAAGAGGGCTTTTGG - Intergenic
1101084660 12:101223425-101223447 GAGGTTGAAAACATGACTCTAGG + Intergenic
1101561709 12:105863396-105863418 GATGGGGAAATCAGGGATCTGGG + Intergenic
1102576842 12:113861048-113861070 GATGAAGAAACCAAGGCTCTGGG + Intronic
1103984834 12:124760356-124760378 GATGAGGAAACCAAGGCTCCGGG + Intergenic
1105616064 13:22013758-22013780 GATGATGGAGAAAGGGCTCCTGG + Intergenic
1105736651 13:23278511-23278533 GATGATGAAGGCTGTGCTCTAGG + Intronic
1106267135 13:28120574-28120596 GATGATTTAAACAAGGCTCTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1106822983 13:33487102-33487124 GATGAAGAAACCAAGGCTCAGGG - Intergenic
1107365572 13:39669908-39669930 AATTATGATAACAGGTCTCTGGG + Intronic
1109332555 13:60947515-60947537 GGAGATGAAAACAGAGTTCTGGG + Intergenic
1112239316 13:97665254-97665276 GAAGATGAAGGCAGGGATCTGGG + Intergenic
1112417458 13:99215653-99215675 GTTGATGAATACAGCCCTCTGGG + Intronic
1114833207 14:26170604-26170626 TATGAAGAAAATAGGGGTCTGGG - Intergenic
1115476614 14:33820710-33820732 GATTTTCAAAACAGGGGTCTTGG + Intergenic
1115489500 14:33945459-33945481 GGCGATGAAAACAGGGATCCAGG + Intronic
1116477633 14:45359901-45359923 AATGATGAAATCTGGGCTCAGGG + Intergenic
1119500186 14:75119535-75119557 GATGAGGAAAATGGTGCTCTAGG + Intronic
1119592287 14:75900799-75900821 GATGATGAGAACAGTGGTCAAGG - Intronic
1119862481 14:77946464-77946486 GATAATGAAAGCAGGTCTCCTGG - Intergenic
1120298908 14:82680607-82680629 GATGAGGAAAAGAGAGGTCTTGG - Intergenic
1120850971 14:89169642-89169664 TCTGATCAATACAGGGCTCTGGG - Intronic
1121262923 14:92579728-92579750 GATGAAGAAAACAGAGTTCCTGG + Intronic
1121727078 14:96160621-96160643 GTGGATGAAGACAGGGCTCAGGG - Intergenic
1121850078 14:97213533-97213555 AATGATAATAACAGGGTTCTCGG + Intergenic
1121937016 14:98029334-98029356 CATGCTGAAATCAGGGCTTTTGG + Intergenic
1122222701 14:100251146-100251168 TGTGATTAAACCAGGGCTCTTGG + Intronic
1122247263 14:100412416-100412438 AGTGGTGAAAACACGGCTCTTGG + Intronic
1122276780 14:100594759-100594781 GGTGATGCATAAAGGGCTCTGGG - Intergenic
1122650759 14:103225322-103225344 GATGATGAAACCAGCTCTGTGGG - Intergenic
1123814670 15:23964755-23964777 GATGATTAAAAATGGGCTCTGGG - Intergenic
1124885310 15:33679773-33679795 GGTGAAGAAATCAAGGCTCTGGG + Intronic
1126578391 15:50220132-50220154 GATGATGAAAACTGAGCCCATGG + Intronic
1126977063 15:54195264-54195286 AATGATGTAAACAGGGGTGTAGG - Intronic
1128262862 15:66244609-66244631 GATGAGGAAAGCGTGGCTCTGGG - Intronic
1128904739 15:71456863-71456885 GATGATTAAATGAGGGTTCTGGG + Intronic
1130563570 15:84977139-84977161 GATGATGAAACCAAGGCCTTTGG - Intergenic
1130659303 15:85817642-85817664 GTTGATTAAAACAGTGCTCACGG + Intergenic
1131819965 15:96262458-96262480 GGAGATGAAAAAAGGGCTTTAGG + Intergenic
1132018588 15:98340403-98340425 AATGTTGACAACAGAGCTCTAGG - Intergenic
1133976020 16:10600447-10600469 GATGATGCAAAAAGGGATCAAGG - Intergenic
1135341664 16:21653659-21653681 GATGCTGACAACAGGGCTGATGG - Intronic
1135743697 16:24998141-24998163 GATGATGCAAACTGGGCCCCGGG + Intronic
1137352313 16:47724285-47724307 GATGAAGAAAGCAGGGCACGGGG + Intergenic
1137597564 16:49734913-49734935 GGTGAGGAAAGCAGAGCTCTGGG + Intronic
1138003604 16:53308743-53308765 GATGGTGAAGACGGTGCTCTGGG + Exonic
1139743598 16:69056614-69056636 TATGATGAAAAAAGGGTTCTTGG - Intronic
1139960344 16:70714032-70714054 GCTGCTGGAAACAGGGCACTCGG + Intronic
1140662083 16:77197758-77197780 GATGATGAAAACATAGTTGTAGG + Intronic
1140669485 16:77263017-77263039 CAACATGAAAACAGAGCTCTTGG - Intronic
1140816548 16:78626504-78626526 TGTGATGAAAACAGACCTCTGGG - Intronic
1141808832 16:86360295-86360317 GCTGATGAAGACAAAGCTCTCGG - Intergenic
1143052138 17:4135003-4135025 GGTGATGAAGACAGGGCTAGAGG + Intronic
1144460415 17:15454228-15454250 GATGGTATAAACAGGACTCTTGG - Intronic
1146218456 17:30997788-30997810 GATGAGGAAACCCAGGCTCTAGG - Intronic
1146301893 17:31696023-31696045 GATGAAGAAATCAAGGCTCAGGG - Intergenic
1146407277 17:32549749-32549771 GATGAGGAAAATGAGGCTCTGGG - Intronic
1147264876 17:39228488-39228510 GATGAAGAAACCAAGGCTATAGG - Intergenic
1147549371 17:41428617-41428639 GTTGATGAAACCTGGGCTCTTGG + Intergenic
1147700786 17:42393285-42393307 GATTATGAAGACAGGGCTTAAGG - Intergenic
1148599505 17:48883512-48883534 GAAGAAGAAAACATGGTTCTTGG + Intergenic
1148731078 17:49837001-49837023 GATGGAGAAAACGGGGCCCTGGG + Intergenic
1149787498 17:59448561-59448583 GATGACGAAATCAGGACTCTTGG - Intergenic
1150808469 17:68337485-68337507 GAGGATGAAGACAGGTCTCCTGG + Intronic
1151885958 17:76923536-76923558 GAAGATGAAGACAGGGCACGTGG + Intronic
1153949381 18:10045393-10045415 AAAGAGGAAAACAGGTCTCTGGG + Intergenic
1155326355 18:24668966-24668988 GAGGCTGAAAACAAGGCACTAGG - Intergenic
1156446773 18:37242525-37242547 GATGGAGAAAACAGGATTCTGGG - Intergenic
1156838853 18:41587550-41587572 GATAAAGTAAAAAGGGCTCTTGG - Intergenic
1157456690 18:47837179-47837201 GATGAAGAAATTAGGACTCTAGG + Exonic
1158618658 18:59011112-59011134 GATCATGAAATCAGGAGTCTGGG + Intergenic
1159566665 18:70058703-70058725 GATGACCAAAATAGAGCTCTAGG - Intronic
1159941622 18:74412936-74412958 GAGGATGAGACCAGGGCCCTGGG - Intergenic
1160167329 18:76525677-76525699 GAAGGTCAAAACTGGGCTCTTGG + Intergenic
1160886507 19:1351934-1351956 GGTGAAGAAAACAGGACTCAGGG + Intergenic
1161146629 19:2682754-2682776 GATGAGGAAACCAAGGCTCATGG - Intronic
1162659446 19:12157563-12157585 AATAATAAAAACAGGGGTCTAGG - Intergenic
1163000184 19:14362307-14362329 GATTTTGAAAATAGAGCTCTCGG + Intergenic
1163866096 19:19774713-19774735 GAGGATGAAAACAGAGGGCTAGG + Intergenic
1164740045 19:30569266-30569288 GATGATCAAAAAATGGCTATGGG - Intronic
1166882518 19:45938061-45938083 GATGATGGAACCAGGGCACTGGG + Exonic
1168048454 19:53810780-53810802 GATGATGAAAAGGAGGCGCTCGG + Exonic
926390222 2:12382584-12382606 GTTCCTGAAAACAGGTCTCTTGG - Intergenic
926653274 2:15370241-15370263 GATGATGAAATCAAGGCCCAGGG - Intronic
926973397 2:18489188-18489210 TATTATGAACACTGGGCTCTTGG - Intergenic
929685922 2:44034522-44034544 GATGAGGAAACCAAGGCTCAGGG - Intergenic
929815409 2:45227285-45227307 AATCAAGAAACCAGGGCTCTAGG + Intergenic
929822605 2:45285367-45285389 CATGATGAACACTGGGCTCAAGG - Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
932322425 2:70831966-70831988 GAAGATGAAATCTGGGCTCTGGG - Intronic
932967814 2:76498539-76498561 CATGATGCAGACAGGGATCTGGG - Intergenic
933060636 2:77733443-77733465 CATGATGAAAACAGGCTTTTAGG - Intergenic
933752082 2:85609349-85609371 CCTGAGGAAAACAGGGCTCAGGG + Intronic
933967612 2:87442800-87442822 GAAGATGAAAGCCAGGCTCTGGG + Intergenic
934713526 2:96530376-96530398 GATGATGAAAGCAGGGGCCTGGG + Intergenic
935127142 2:100234655-100234677 GATGAGAAAACCAGGACTCTGGG - Intergenic
936326185 2:111507696-111507718 GAAGATGAAAGCCAGGCTCTGGG - Intergenic
937592892 2:123635189-123635211 GATGAAGAAAACTGGGCACATGG + Intergenic
937880758 2:126862865-126862887 GATGCTGAAAGCAGGAGTCTGGG - Intergenic
939953450 2:148503720-148503742 GATAAGGAAAACAGGGATCAAGG + Intronic
940633806 2:156272251-156272273 GATGAAGAAAACAGGGGACTGGG + Intergenic
940789891 2:158020962-158020984 AATGATGAGAACAGGGATCGAGG + Intronic
941704553 2:168644168-168644190 GATGATGAAAATAGATGTCTAGG + Intronic
941751526 2:169140086-169140108 GTTGATTACAACAGGGCTGTGGG - Intronic
941835016 2:170006619-170006641 GATTATGAAAACAGGGGTATGGG + Intronic
942512307 2:176715496-176715518 GATGAGAAAACCATGGCTCTGGG - Intergenic
943336318 2:186619688-186619710 AATTAAGAAAAAAGGGCTCTTGG + Intronic
944020872 2:195102597-195102619 GATGAAGAAAACAGGACTTAAGG - Intergenic
946434219 2:219641306-219641328 GTTGACAAAAACAGGGCTCAGGG - Intronic
947077277 2:226358965-226358987 GATTCTGAAAATAAGGCTCTGGG - Intergenic
947794880 2:232887982-232888004 GATGAGGAAAACAGTGCATTGGG + Intronic
1169256415 20:4103226-4103248 GACAATGAATACTGGGCTCTTGG - Intergenic
1169801002 20:9511616-9511638 ATTGATGAAAAAAGGTCTCTTGG - Intergenic
1170396150 20:15927497-15927519 GATGAAGAAATCAAGGCTGTGGG - Intronic
1173766219 20:45612009-45612031 GATGGGGAAAACCAGGCTCTGGG - Intronic
1173787730 20:45806875-45806897 GATGATACAAACAAAGCTCTTGG - Intronic
1175055411 20:56193202-56193224 GATGATGGAAACAGGGCAGAGGG - Intergenic
1175333839 20:58182239-58182261 AATGATTAAAACAAGGCTCTTGG - Intergenic
1176201610 20:63863311-63863333 GATGATGGGAACGGGGCTGTGGG + Intergenic
1176918823 21:14661490-14661512 AATGATGATTACAAGGCTCTGGG - Intergenic
1177820458 21:26025512-26025534 GATGGTGAAAACATGACCCTGGG + Intronic
1179395717 21:41038539-41038561 GATGATGACAACTGGGCCTTGGG - Intergenic
1180376182 22:12096173-12096195 ATTGGAGAAAACAGGGCTCTGGG + Intergenic
1181856092 22:25782556-25782578 GAGGAGGAAACCAAGGCTCTGGG - Intronic
1182867655 22:33618402-33618424 GATGAGGAAACCAAGGCTCAGGG - Intronic
1183746527 22:39695010-39695032 GATGCTGAACTCAGGGCTCAGGG + Intergenic
1184124260 22:42475924-42475946 GATGATTTAAAGGGGGCTCTCGG - Intergenic
1184415188 22:44348053-44348075 GAAGATGAAGACAGGGGCCTGGG - Intergenic
1184607104 22:45580495-45580517 GATGATGAAACCCTGGCTCCTGG - Intronic
1185264905 22:49896198-49896220 GGTGCTGACAACAGGGCCCTGGG + Intergenic
950171924 3:10844680-10844702 GGTAATGAAGACAGGGTTCTAGG + Intronic
950189144 3:10964540-10964562 GATGATGTCAACACCGCTCTTGG + Intergenic
951232654 3:20197845-20197867 GATGAAGAAGACAAGGATCTAGG + Intergenic
951806442 3:26649477-26649499 GAGTATGAAAACAGGGATCTGGG - Intronic
952183282 3:30941867-30941889 GATAAAGCAAGCAGGGCTCTCGG + Intergenic
954976819 3:54703811-54703833 GATAATGAAACAAGGGCTTTGGG + Intronic
956787802 3:72656799-72656821 TGTGATGAAAACTGGGCTCTAGG + Intergenic
956791885 3:72686320-72686342 CATGATGGAAACAGGGCCCATGG + Intergenic
959663146 3:108891734-108891756 GATGAAGAAAACAGGAATCAGGG + Intergenic
962571081 3:136714118-136714140 GGTGATGCAATCATGGCTCTGGG - Intronic
962677540 3:137768053-137768075 GATGAAGCTTACAGGGCTCTGGG + Intergenic
962857993 3:139367103-139367125 AATTGTGAAAACAGGGCTTTGGG - Exonic
963904111 3:150759851-150759873 GATGAGGAAATCAAGGCCCTGGG + Intronic
965237348 3:166142393-166142415 GATGATGCAAACAAGGCTAGGGG - Intergenic
969032287 4:4225004-4225026 GATGCTGAAACCAGGGTTCAGGG + Intronic
970280271 4:14447250-14447272 GATGATGAAATGAAGACTCTGGG - Intergenic
970465111 4:16314837-16314859 GATGAGGAAACCAGGGCTCAGGG - Intergenic
972446370 4:39148160-39148182 CATGATGAAACCTGGCCTCTGGG - Intergenic
972592521 4:40501425-40501447 GATGCTGAAAACAAGCATCTAGG + Intronic
973537821 4:51901543-51901565 GCTAATGCAAACGGGGCTCTAGG - Intronic
974843673 4:67325478-67325500 GGTGAAGAAATCAAGGCTCTTGG - Intergenic
975709319 4:77143734-77143756 AATGGTGAAATCAGGGCTTTTGG - Intergenic
976480627 4:85540318-85540340 GATGTTTAAAATAGGCCTCTGGG - Intronic
977154339 4:93554526-93554548 AATGATGAAATCAGGGCAATTGG + Intronic
979552631 4:122008387-122008409 GATGAGGAAACCAAGGCTCTTGG - Intergenic
979754628 4:124325562-124325584 CAGGATGAATTCAGGGCTCTAGG + Intergenic
980211256 4:129791220-129791242 GATGAAGAAAAGAGGGCTATGGG + Intergenic
980240292 4:130164620-130164642 GATGATGGAAATATGGCTGTTGG + Intergenic
981022772 4:140046681-140046703 GATGAGGAAGACACAGCTCTGGG + Intronic
982059041 4:151584603-151584625 GATGCTTAAAAGAGAGCTCTGGG - Intronic
983573066 4:169231057-169231079 GATGAAGAAACTTGGGCTCTGGG - Intronic
984715233 4:182918215-182918237 GATGAGAAAAACAGGGCAATAGG + Intergenic
1202757783 4_GL000008v2_random:81613-81635 ATTGGAGAAAACAGGGCTCTGGG + Intergenic
985788051 5:1910239-1910261 GATGAGGAAAAAACAGCTCTGGG + Intergenic
986291093 5:6399488-6399510 GATTAAGAAAACACAGCTCTGGG - Intergenic
987830324 5:23087156-23087178 TATGGTGCAAACAGTGCTCTTGG - Intergenic
988813426 5:34807252-34807274 GATGAGCCAAGCAGGGCTCTAGG + Intronic
990007434 5:50960417-50960439 GATGATGTAAACATGGCGATGGG + Intergenic
991036889 5:62136227-62136249 GAAGATGAAATCAGTGCTTTTGG + Intergenic
992325248 5:75654095-75654117 GATGATGTGAGCAGGGCTATGGG - Intronic
992328477 5:75688382-75688404 AATGAGGAAAACAGGCCCCTGGG + Intronic
994339413 5:98608751-98608773 TATGAGGAAAACAGGAGTCTAGG + Intergenic
994449073 5:99917604-99917626 GATGGTGAAAACAAGTGTCTTGG + Intergenic
994508311 5:100670474-100670496 GATGATGAAATCAGGGTAATTGG + Intergenic
995860938 5:116639804-116639826 GATGAGGCAAACAGGACACTGGG - Intergenic
996394999 5:123004756-123004778 GATGGAGAAAACAAGGCTCACGG - Intronic
999036481 5:148357129-148357151 GCTCTTTAAAACAGGGCTCTAGG + Intergenic
999470708 5:151852378-151852400 GATCATGTGAACAGGGCTCAGGG - Intronic
999635425 5:153616899-153616921 GATGATAAAAACTGGGTTGTTGG + Intronic
1000665352 5:163988321-163988343 CATGATGAAAACAGTGCTGTGGG + Intergenic
1001140806 5:169142319-169142341 AAGGGTAAAAACAGGGCTCTGGG + Intronic
1001229792 5:169976466-169976488 GATGATGAATGTAGGGCCCTGGG + Intronic
1001967973 5:175926674-175926696 GATGCTGCAAACTGGCCTCTTGG + Intronic
1002603893 5:180370710-180370732 GATGAGGAAATCAAGGCTCCAGG - Intergenic
1003654815 6:7996789-7996811 CATGATGAAAGCATTGCTCTAGG - Intronic
1003862648 6:10336577-10336599 TATGAAGAAAAGAAGGCTCTAGG - Intergenic
1004190336 6:13458049-13458071 GATGAGGAAAACAGGGCAAAGGG - Intronic
1005471686 6:26167258-26167280 TATGATGAAAAGAGAGATCTCGG - Intronic
1005963914 6:30713010-30713032 GATGATGACAGCAGGCCTCCTGG - Exonic
1006294324 6:33163256-33163278 GATGTTGAAGACAGGGGTCTCGG - Exonic
1006687866 6:35852677-35852699 GATGATGGAGAAAGAGCTCTTGG + Intronic
1006908976 6:37551683-37551705 GATGAGGAACACAAGGCTCGGGG + Intergenic
1007352835 6:41286634-41286656 GATGAGGAAGACCAGGCTCTGGG - Exonic
1011309840 6:85969724-85969746 GATGTTGAAAGGAGGGGTCTGGG - Intergenic
1012499214 6:99869989-99870011 GCTGATGAACACAGAGCTGTTGG - Intergenic
1013708087 6:112863221-112863243 GAAGAAGAAACCAGGGCTCTGGG - Intergenic
1014964221 6:127726608-127726630 CCTGATGAAAACTGGGATCTAGG + Intronic
1015620384 6:135126160-135126182 GCTTATGAAAGCAGGGATCTGGG + Intergenic
1018319236 6:162588849-162588871 GGTGATGAAAAATGAGCTCTGGG - Intronic
1018723092 6:166588735-166588757 GATGATGGACACAGGGTTCCCGG + Intronic
1019762139 7:2821038-2821060 GTTGATGAAAACATGGATGTAGG - Intronic
1021524414 7:21571156-21571178 GGTGATGAAAACAGGAGTTTTGG + Intronic
1022591972 7:31672055-31672077 AATCATAAAAACAGGGCTTTAGG - Intergenic
1022977562 7:35573257-35573279 GATGATGAAGACGAGGCTCCTGG + Intergenic
1023798391 7:43812303-43812325 GATGATAATAACAGGGATTTGGG + Intergenic
1024530980 7:50392604-50392626 AAGGATGGAACCAGGGCTCTAGG - Intronic
1024594406 7:50919901-50919923 GCTGATGACAAAAGGGCTGTGGG + Intergenic
1024663094 7:51518371-51518393 GAGGATGAAGGCAGGGCTCAGGG + Intergenic
1027529862 7:79316857-79316879 GATGAGGAAATCAAGGCTCACGG + Intronic
1031101919 7:117491613-117491635 GAAGATGAAAACAGAGATCAGGG - Intronic
1031146136 7:117999121-117999143 GATAATGATGACAGGACTCTAGG + Intergenic
1031478365 7:122249326-122249348 GAAGATGAAGGCAGGGATCTGGG + Intergenic
1032369849 7:131337662-131337684 GATGATGGAAATAGGCCTATAGG - Intronic
1032466500 7:132149055-132149077 GCTGATGAAATCAAGGCTGTAGG + Intronic
1032685213 7:134225710-134225732 GATTATGAATTCAGTGCTCTTGG + Intronic
1033834108 7:145288113-145288135 GATTATGAAAAGGGGGCTCAAGG + Intergenic
1034861693 7:154600597-154600619 GATGATGAAACCAAGGCTAAAGG + Intronic
1036770927 8:11577968-11577990 GATGAGGAAACCAAGGCTCATGG + Intergenic
1038281389 8:26168467-26168489 GATGAGGAAAATAGGGCTCAGGG - Intergenic
1038435553 8:27533238-27533260 GATGAGGAAACCGAGGCTCTAGG + Intronic
1038443814 8:27589263-27589285 GAAGATGTAAACAGGGATGTGGG - Intergenic
1040766940 8:50923126-50923148 GATAAAGAAAACAGTGCTTTGGG - Intergenic
1041633281 8:60113392-60113414 GCTGATGAAAACTGAGCTATTGG - Intergenic
1047059177 8:121204034-121204056 AATGATGAAATCAGGGTTATAGG - Intergenic
1047338051 8:123954994-123955016 ACTGCTGAGAACAGGGCTCTGGG - Intronic
1047623964 8:126636525-126636547 GATGAGGAAACGGGGGCTCTGGG - Intergenic
1047689410 8:127336019-127336041 GATGATGATGACTGGGCTGTGGG + Intergenic
1047702835 8:127466924-127466946 GATGAGGAAACTGGGGCTCTAGG + Intergenic
1048211172 8:132455593-132455615 GGTGATGAATCCAGGCCTCTTGG - Intronic
1048230552 8:132636437-132636459 GATGAGGAAGTCAGGGCTCAGGG - Intronic
1048383746 8:133892198-133892220 TATGCTGAATACAGAGCTCTAGG + Intergenic
1050431292 9:5564617-5564639 GATGATGAAAACAGTGTTTGGGG - Intronic
1052545243 9:29869267-29869289 GCTGCTGGAAACAGGACTCTGGG - Intergenic
1052785677 9:32826048-32826070 GATGAGGAAAACAAGGCACAAGG + Intergenic
1053600409 9:39603817-39603839 GGTGAGGAAAACAGGCCTCGGGG + Intergenic
1053858060 9:42357673-42357695 GGTGAGGAAAACAGGCCTCGGGG + Intergenic
1054253120 9:62738567-62738589 GGTGAGGAAAACAGGCCTCGGGG - Intergenic
1054567236 9:66773066-66773088 GGTGAGGAAAACAGGCCTCGGGG - Intergenic
1054703389 9:68436779-68436801 GAAGATGAAACCAGAGCTCAAGG + Intronic
1055310644 9:74976141-74976163 TATAATGAGGACAGGGCTCTGGG + Intergenic
1056208111 9:84339747-84339769 GATGATCAAACTTGGGCTCTGGG + Intronic
1057288189 9:93777628-93777650 GAGGAGGAAAAGAAGGCTCTAGG + Intergenic
1059507324 9:114811752-114811774 AAAGATGAATACAGGACTCTGGG + Intergenic
1059705781 9:116822026-116822048 GATGAGGAAGGCTGGGCTCTGGG - Intronic
1060280502 9:122212952-122212974 GATGAGGAAACCAGGGCTCAAGG + Intronic
1060729645 9:126029305-126029327 GATGAGGAAAATGAGGCTCTGGG + Intergenic
1203538571 Un_KI270743v1:66477-66499 ATTGGAGAAAACAGGGCTCTGGG + Intergenic
1186577286 X:10779887-10779909 GAGGATCAAGACTGGGCTCTCGG + Intronic
1187316675 X:18202130-18202152 GATGATGAAAGAAGGAATCTTGG + Intronic
1187806527 X:23127263-23127285 GATTATGAAAACAGGGTTGAAGG - Intergenic
1188627504 X:32304299-32304321 GATTATGAAAACAGTGCTGCTGG + Intronic
1188670583 X:32877263-32877285 AATGATAACCACAGGGCTCTTGG - Intronic
1189198395 X:39170747-39170769 GGTGATGACAACAGGGCCTTTGG - Intergenic
1190816391 X:53933717-53933739 GATGATGAATATAGAACTCTGGG + Intergenic
1191668023 X:63723261-63723283 GATGAGGAAATCAGGGCTCAGGG + Intronic
1192273754 X:69609405-69609427 GATGAGGAAACCAAGGCTCAGGG - Intergenic
1194093621 X:89607643-89607665 GATGAGGAAAAAAGTGCTTTGGG + Intergenic
1195331654 X:103807865-103807887 AATGGTGGAAACAGGCCTCTGGG - Intergenic
1195698783 X:107686254-107686276 GATGAGGAAATCATGGCTCAGGG + Intergenic
1195947341 X:110229511-110229533 GAGGATGAAAAAAGGGCAATGGG + Intronic
1196288568 X:113912548-113912570 GAAGATGAAAAAAGTGCTATAGG + Intergenic
1200021725 X:153217357-153217379 GATTATGTAAATAGTGCTCTTGG + Intergenic
1200446252 Y:3263774-3263796 GATGAGGAAAAAAGTGCTTTGGG + Intergenic