ID: 911072692

View in Genome Browser
Species Human (GRCh38)
Location 1:93845214-93845236
Sequence CCTCTGTATGGTTTTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911072686_911072692 -3 Left 911072686 1:93845194-93845216 CCAATACCCCAGGCAGAATTCCT 0: 1
1: 0
2: 2
3: 11
4: 157
Right 911072692 1:93845214-93845236 CCTCTGTATGGTTTTCCCACAGG No data
911072684_911072692 19 Left 911072684 1:93845172-93845194 CCTCATCATTTGAGATTTGGCTC No data
Right 911072692 1:93845214-93845236 CCTCTGTATGGTTTTCCCACAGG No data
911072688_911072692 -10 Left 911072688 1:93845201-93845223 CCCAGGCAGAATTCCTCTGTATG No data
Right 911072692 1:93845214-93845236 CCTCTGTATGGTTTTCCCACAGG No data
911072687_911072692 -9 Left 911072687 1:93845200-93845222 CCCCAGGCAGAATTCCTCTGTAT 0: 1
1: 0
2: 3
3: 15
4: 202
Right 911072692 1:93845214-93845236 CCTCTGTATGGTTTTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911072692 Original CRISPR CCTCTGTATGGTTTTCCCAC AGG Intronic