ID: 911075710

View in Genome Browser
Species Human (GRCh38)
Location 1:93872418-93872440
Sequence TAATCCTGTCCCTAATTTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911075710_911075712 -4 Left 911075710 1:93872418-93872440 CCGCTAAATTAGGGACAGGATTA 0: 1
1: 0
2: 1
3: 15
4: 116
Right 911075712 1:93872437-93872459 ATTATCAGTTTCATAAATGAGGG 0: 1
1: 0
2: 2
3: 44
4: 544
911075710_911075711 -5 Left 911075710 1:93872418-93872440 CCGCTAAATTAGGGACAGGATTA 0: 1
1: 0
2: 1
3: 15
4: 116
Right 911075711 1:93872436-93872458 GATTATCAGTTTCATAAATGAGG 0: 1
1: 0
2: 0
3: 20
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911075710 Original CRISPR TAATCCTGTCCCTAATTTAG CGG (reversed) Intronic
904951448 1:34243192-34243214 TTATCCTGTTCCGAATTTATGGG + Intergenic
908581110 1:65518336-65518358 TAATCTTGTCTCTATTTTGGGGG + Intronic
908842190 1:68291246-68291268 TAATTCTATCCCTAATTTAGAGG + Intergenic
910283601 1:85529197-85529219 GAATCCTGACTCTAATTCAGAGG + Intronic
911075710 1:93872418-93872440 TAATCCTGTCCCTAATTTAGCGG - Intronic
913672420 1:121110154-121110176 TTGTGCTGTCCCTAATTTAGAGG + Intergenic
914024187 1:143897518-143897540 TTGTGCTGTCCCTAATTTAGAGG + Intergenic
914206414 1:145533793-145533815 GAATCCTGACTCTAATTCAGAGG - Intergenic
914662676 1:149805545-149805567 TTGTGCTGTCCCTAATTTAGAGG + Intronic
915848786 1:159298657-159298679 TCCTCCTGGCCCTAATATAGAGG + Intronic
916218660 1:162421113-162421135 TGATCATATCCCTAATTTTGTGG - Intergenic
916676747 1:167070396-167070418 TAATCATATACCTACTTTAGGGG - Intronic
917740681 1:177959345-177959367 TTTTACTGTCCCTATTTTAGGGG - Intronic
918041210 1:180915111-180915133 TAATCCTGTCCCTAACACAATGG - Intronic
918996473 1:191767819-191767841 TTATCCTGTCTCTTATTTAATGG + Intergenic
921570035 1:216766609-216766631 GAATTCTGTACCTGATTTAGTGG + Intronic
923399648 1:233603956-233603978 TAATTCAGTCCCTAGATTAGGGG - Intergenic
923439727 1:234005684-234005706 TCTTCCTGCCCCTAATTTTGTGG - Intronic
924089417 1:240487130-240487152 TACTCCTCTCCCAATTTTAGGGG - Intergenic
924643890 1:245859306-245859328 TAATACTGTCTCTTATTTTGGGG - Intronic
1069316875 10:67115588-67115610 AAATCCTGTGGCTAATTTTGTGG - Intronic
1076415512 10:130284714-130284736 AAATCCTGTCCCTAAATCATAGG - Intergenic
1080480982 11:32650297-32650319 TAATTTTGTCACTAATTTTGAGG + Intronic
1081616499 11:44594543-44594565 TAACCCTGTCCCTGCCTTAGAGG - Intronic
1085083446 11:73651712-73651734 TATTCCTGTCCCTGCTTTACTGG + Intronic
1086043509 11:82506322-82506344 AAATCCTGTCCCTAATTGGTTGG + Intergenic
1094250602 12:28355760-28355782 TAATCCTGTTTCTGATTGAGAGG + Intronic
1101177248 12:102166606-102166628 TATTACTATTCCTAATTTAGAGG + Intronic
1102066253 12:109978372-109978394 TGAGCCTGTCCCAAATTTAGAGG + Intronic
1104588504 12:130066258-130066280 TTATCCTGTCCCTGAGTCAGTGG - Intergenic
1107910026 13:45096865-45096887 TAATCATGTACCTAATGTAGGGG + Intergenic
1110872146 13:80464829-80464851 TAATCTTGTTCATAATTTAAAGG + Intergenic
1114163815 14:20198403-20198425 TAATCTTGTCTTTAATTTTGGGG + Exonic
1115128576 14:30025801-30025823 TAATCCTGACTTTATTTTAGGGG - Intronic
1116605203 14:46983256-46983278 TAATCATGTACCTTATTCAGTGG + Intronic
1119754742 14:77108082-77108104 TAATCCTGACCCTAATAATGGGG - Intronic
1119977491 14:79041348-79041370 TAATCCTTTCCCAAATTTAACGG - Intronic
1120268093 14:82276660-82276682 TAATCTTGTGGCTAATTTATTGG + Intergenic
1124697092 15:31872458-31872480 CAGTCCTGTCCTGAATTTAGGGG + Intergenic
1125890825 15:43265799-43265821 TAATCCTGTCCCCTATTGATGGG - Intronic
1127275731 15:57442142-57442164 GAACCCTGTCCCAAATTGAGTGG + Intronic
1137891310 16:52165479-52165501 TAGTCCTGTCAATAATTCAGAGG - Intergenic
1138080528 16:54086388-54086410 TAATCTTGTCCTTAATTGTGTGG - Intronic
1142758655 17:2030280-2030302 TGGTCCTGTCCCTAACTTGGGGG - Intronic
1143273672 17:5694171-5694193 TAATCATGTCCCCATTTTACCGG + Intergenic
1143460833 17:7102501-7102523 CAATCCTGTACCTGAGTTAGTGG + Intronic
1150572872 17:66403305-66403327 CATTCCTGACCCTGATTTAGTGG + Intronic
1203164889 17_GL000205v2_random:84749-84771 CAAGCCTTTCCCTAATTTACTGG + Intergenic
1154409136 18:14126798-14126820 TAATTCTGCCCCCATTTTAGAGG - Intronic
1156108610 18:33696125-33696147 TAACTTTGACCCTAATTTAGGGG - Intronic
1159508938 18:69371014-69371036 GAATCCTGTCTCTTATTTACTGG - Intergenic
1162304985 19:9866961-9866983 TAATCCTGGACCTGTTTTAGAGG - Intronic
1162459358 19:10805202-10805224 GACTCCTGACCCAAATTTAGAGG - Intronic
1164455195 19:28400846-28400868 TAATCCTGACGCTATTTTTGAGG - Intergenic
936464301 2:112733468-112733490 TACTTCTGTCCAGAATTTAGGGG - Intronic
937575195 2:123411332-123411354 TAATCTTCCCCCAAATTTAGAGG - Intergenic
946669488 2:222087349-222087371 TAATCCTTTCACTAATTGATAGG - Intergenic
947647457 2:231754123-231754145 TAAACCTCTCCCTAACTTAGAGG + Intronic
1169711498 20:8569609-8569631 TAATCATTTCCCTATTTTTGTGG - Intronic
1172295389 20:33806853-33806875 TAATACTGTTCCTATTTTATAGG - Intergenic
1173306017 20:41850574-41850596 TTGTCCTGTCTCTAACTTAGTGG + Intergenic
1173306295 20:41853646-41853668 TAATCATGGCAATAATTTAGAGG - Intergenic
1173887176 20:46469992-46470014 GAATCTTGTCCCTATTTTAAGGG - Intergenic
1176336739 21:5606066-5606088 CAAGCCTTTCCCTAATTCAGTGG - Intergenic
1176391018 21:6214882-6214904 CAAGCCTTTCCCTAATTCAGTGG + Intergenic
1176406860 21:6374338-6374360 CAAGCCTTTCCCTAATTTACTGG - Intergenic
1176470401 21:7101292-7101314 CAAGCCTTTCCCTAATTCAGTGG - Intergenic
1176493962 21:7483070-7483092 CAAGCCTTTCCCTAATTCAGTGG - Intergenic
1176506680 21:7655313-7655335 CAAGCCTTTCCCTAATTCAGTGG + Intergenic
1176864080 21:14033089-14033111 TAATTCTGCCCCCATTTTAGAGG + Intergenic
1179320670 21:40288055-40288077 TAATGCTGTTCTTAATTTAGAGG - Intronic
1179793545 21:43769254-43769276 TTATTCTGTCTCTAATCTAGTGG + Intergenic
951049741 3:18080969-18080991 TATTCTTGTGCCTAACTTAGGGG - Intronic
957139659 3:76336504-76336526 TAATCATGCCTCAAATTTAGTGG - Intronic
959788998 3:110334150-110334172 TAAAACAGTACCTAATTTAGGGG - Intergenic
960913216 3:122669819-122669841 CAATCCTCCCCCAAATTTAGTGG - Intergenic
963107251 3:141657876-141657898 TGGTCATGTCCCTAATCTAGGGG + Intergenic
963996851 3:151719527-151719549 TAACCCTATCCGTAATTTCGTGG + Intergenic
965966413 3:174495849-174495871 TAATCCTGTCATTCATTTAATGG - Intronic
966609649 3:181855611-181855633 TCATCCTTTCCCTAGTTCAGTGG + Intergenic
969911595 4:10452210-10452232 TGATCCTGTCCCTCATTTGCAGG + Intronic
970905510 4:21211750-21211772 TAATTGTGTCCCTAACTCAGAGG - Intronic
970969982 4:21971077-21971099 TGTTCCTGTCACAAATTTAGTGG - Intergenic
972981686 4:44712063-44712085 TATTCCTGTCTATATTTTAGAGG - Intronic
973595531 4:52484964-52484986 AAATACTGTCCCTAGCTTAGTGG + Intergenic
974771257 4:66416941-66416963 TAATGCAGTCCCTATTTTACAGG + Intergenic
976482459 4:85560817-85560839 TAAACCTAACCCAAATTTAGTGG - Intronic
977186870 4:93949987-93950009 TGATCCTGTCACTTAGTTAGTGG - Intergenic
980317708 4:131224473-131224495 TAATAATGAACCTAATTTAGGGG + Intergenic
987516001 5:18909112-18909134 TAAGTCTGTCCATAATTTATAGG - Intergenic
988227845 5:28435940-28435962 TAATCCTAGCCCTAATTTTGGGG + Intergenic
988835116 5:35024637-35024659 TAATCCAGCCTCTAAATTAGAGG - Intronic
989815259 5:45728936-45728958 TAAATCTGTCCTTAATTTATAGG - Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
994393488 5:99210327-99210349 TGATACTGTTCCTAATTTCGAGG - Intergenic
995252577 5:110010857-110010879 TCATCCTTTCCCTATTGTAGTGG + Intergenic
996164433 5:120207768-120207790 TAGTCCTGTGCCTAAATTAGCGG + Intergenic
1002977960 6:2104541-2104563 CAATCATGTCTCTAATCTAGAGG + Intronic
1008628510 6:53341876-53341898 TAATCCTGTGCCTACTTTGGAGG - Intronic
1009319978 6:62275868-62275890 TAATATTGTCCCTATTTTATAGG - Intronic
1010223955 6:73471750-73471772 TGATCCTGTCCATATTTTATAGG + Intronic
1013534227 6:111048883-111048905 TAATCCTATTTCTAATTTTGAGG + Intergenic
1016606084 6:145928838-145928860 TAATCTTCTCCCTTATTTAAAGG - Intronic
1016755503 6:147681025-147681047 TATTCCTGTCTCTAATTTTCTGG + Intronic
1016929611 6:149391333-149391355 TCATCCTGTCCCACATTTAGTGG + Intronic
1019339681 7:503160-503182 TAAGCCTGTCCCTAATTGCTAGG + Intronic
1021814771 7:24436391-24436413 TAAACCAGTCCCAAACTTAGTGG - Intergenic
1021934780 7:25619162-25619184 TCATCCTCTCCCTAGTCTAGAGG - Intergenic
1022944546 7:35269086-35269108 CACTCATGTCCCTAATTGAGTGG + Intergenic
1024320968 7:48069036-48069058 TAATCCTGAAGCTAATCTAGGGG + Intergenic
1028566346 7:92235848-92235870 TAATACTGTACATACTTTAGGGG + Intronic
1030242923 7:107349352-107349374 AAATCCTTTCCCTATTTTAGGGG + Intronic
1030710814 7:112747118-112747140 AAATTGTGTCCCCAATTTAGAGG - Intergenic
1032668816 7:134065092-134065114 TATTCCTAGCCCTAAATTAGAGG - Exonic
1033000898 7:137503183-137503205 TAACCTTGTCTGTAATTTAGGGG + Intronic
1033101489 7:138476616-138476638 TAATGCTGTACCTATTTTGGGGG - Intronic
1040075962 8:43230816-43230838 TAATCCAGTCTATCATTTAGTGG - Intergenic
1040831626 8:51683470-51683492 TAATCCTTTACCTAATATTGGGG + Intronic
1040877789 8:52170966-52170988 TACTCCTCTCCCTAATTTTGTGG + Intronic
1043254288 8:78113803-78113825 TATTCCTGTCACTAATTGGGGGG - Intergenic
1045043959 8:98256746-98256768 TAATCCTGTGTTTAATTTTGAGG - Intronic
1051350476 9:16193852-16193874 TACTCCAGTCCCCAACTTAGAGG + Intergenic
1052296718 9:26904566-26904588 TAATACTGGCCCTCATTTAAAGG + Exonic
1052961254 9:34298985-34299007 TAATTATTTCCATAATTTAGGGG + Intronic
1055652745 9:78422835-78422857 AAATAATGTCCCTAATTTACAGG + Intergenic
1056560685 9:87726620-87726642 TGACCCCGTCCCTGATTTAGGGG + Intronic
1057734523 9:97643098-97643120 TAATCCTGTTCCAAAGTTAATGG + Intronic
1203424912 Un_GL000195v1:28836-28858 CAAGCCTTTCCCTAATTCAGTGG + Intergenic
1203705562 Un_KI270742v1:39795-39817 GAATCATGTCCCTGATTTTGAGG + Intergenic
1188362747 X:29276105-29276127 TAATCCTTTTCCCAATTTAGAGG - Intronic
1193235759 X:79105314-79105336 TAATCCTGTTCATGATTTCGTGG - Intergenic
1199671503 X:150151876-150151898 TAATACTGTCCCTATATTATAGG - Intergenic
1201451550 Y:14121046-14121068 TACACCTGTAACTAATTTAGTGG - Intergenic