ID: 911080091

View in Genome Browser
Species Human (GRCh38)
Location 1:93920197-93920219
Sequence TGTTATGTAAGATTGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911080088_911080091 -7 Left 911080088 1:93920181-93920203 CCAAAATATCCAATACTGTTATG No data
Right 911080091 1:93920197-93920219 TGTTATGTAAGATTGCCTGGAGG No data
911080087_911080091 10 Left 911080087 1:93920164-93920186 CCATTGATAATATGAATCCAAAA No data
Right 911080091 1:93920197-93920219 TGTTATGTAAGATTGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911080091 Original CRISPR TGTTATGTAAGATTGCCTGG AGG Intergenic
No off target data available for this crispr