ID: 911082232

View in Genome Browser
Species Human (GRCh38)
Location 1:93944542-93944564
Sequence GTTGTATAGTGATCAAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911082230_911082232 -9 Left 911082230 1:93944528-93944550 CCATAAATGTATATGTTGTATAG No data
Right 911082232 1:93944542-93944564 GTTGTATAGTGATCAAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911082232 Original CRISPR GTTGTATAGTGATCAAATCA GGG Intergenic
No off target data available for this crispr