ID: 911087800

View in Genome Browser
Species Human (GRCh38)
Location 1:93993674-93993696
Sequence GGGAAGCATGAAAGTGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911087794_911087800 6 Left 911087794 1:93993645-93993667 CCTTGACCACTTCCTGTAGGGGT 0: 1
1: 0
2: 1
3: 8
4: 138
Right 911087800 1:93993674-93993696 GGGAAGCATGAAAGTGTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 231
911087792_911087800 7 Left 911087792 1:93993644-93993666 CCCTTGACCACTTCCTGTAGGGG No data
Right 911087800 1:93993674-93993696 GGGAAGCATGAAAGTGTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 231
911087788_911087800 24 Left 911087788 1:93993627-93993649 CCCTGAGGTATAGAATTCCCTTG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 911087800 1:93993674-93993696 GGGAAGCATGAAAGTGTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 231
911087799_911087800 -6 Left 911087799 1:93993657-93993679 CCTGTAGGGGTGGCTCTGGGAAG 0: 1
1: 0
2: 3
3: 24
4: 199
Right 911087800 1:93993674-93993696 GGGAAGCATGAAAGTGTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 231
911087789_911087800 23 Left 911087789 1:93993628-93993650 CCTGAGGTATAGAATTCCCTTGA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 911087800 1:93993674-93993696 GGGAAGCATGAAAGTGTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 231
911087796_911087800 0 Left 911087796 1:93993651-93993673 CCACTTCCTGTAGGGGTGGCTCT No data
Right 911087800 1:93993674-93993696 GGGAAGCATGAAAGTGTGACTGG 0: 1
1: 0
2: 1
3: 12
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911087800 Original CRISPR GGGAAGCATGAAAGTGTGAC TGG Intronic