ID: 911090467

View in Genome Browser
Species Human (GRCh38)
Location 1:94013340-94013362
Sequence GTCTCAGGGGTCCACGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911090457_911090467 18 Left 911090457 1:94013299-94013321 CCTAGCAGCCACGAAACCCTAAC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 911090467 1:94013340-94013362 GTCTCAGGGGTCCACGGGTCTGG No data
911090460_911090467 2 Left 911090460 1:94013315-94013337 CCCTAACAAGATCTGGAAAGAGT No data
Right 911090467 1:94013340-94013362 GTCTCAGGGGTCCACGGGTCTGG No data
911090458_911090467 10 Left 911090458 1:94013307-94013329 CCACGAAACCCTAACAAGATCTG 0: 1
1: 0
2: 1
3: 4
4: 59
Right 911090467 1:94013340-94013362 GTCTCAGGGGTCCACGGGTCTGG No data
911090461_911090467 1 Left 911090461 1:94013316-94013338 CCTAACAAGATCTGGAAAGAGTC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 911090467 1:94013340-94013362 GTCTCAGGGGTCCACGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911090467 Original CRISPR GTCTCAGGGGTCCACGGGTC TGG Intronic
No off target data available for this crispr