ID: 911091776

View in Genome Browser
Species Human (GRCh38)
Location 1:94022893-94022915
Sequence AGTTCCTGAGGGAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911091764_911091776 23 Left 911091764 1:94022847-94022869 CCAGGAAAGCACATACATGTCAG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG No data
911091767_911091776 0 Left 911091767 1:94022870-94022892 CCCCGCACCTGTTCTGGAGGTGC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG No data
911091769_911091776 -2 Left 911091769 1:94022872-94022894 CCGCACCTGTTCTGGAGGTGCAG 0: 1
1: 0
2: 2
3: 10
4: 226
Right 911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG No data
911091770_911091776 -7 Left 911091770 1:94022877-94022899 CCTGTTCTGGAGGTGCAGTTCCT No data
Right 911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG No data
911091763_911091776 24 Left 911091763 1:94022846-94022868 CCCAGGAAAGCACATACATGTCA 0: 1
1: 0
2: 0
3: 14
4: 205
Right 911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG No data
911091768_911091776 -1 Left 911091768 1:94022871-94022893 CCCGCACCTGTTCTGGAGGTGCA 0: 1
1: 0
2: 0
3: 20
4: 234
Right 911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911091776 Original CRISPR AGTTCCTGAGGGAGGCTGGG AGG Intronic
No off target data available for this crispr