ID: 911093793

View in Genome Browser
Species Human (GRCh38)
Location 1:94039455-94039477
Sequence ACATTCTCTCACATAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911093790_911093793 1 Left 911093790 1:94039431-94039453 CCTGTGTGGGAATACGCTTCTCA No data
Right 911093793 1:94039455-94039477 ACATTCTCTCACATAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911093793 Original CRISPR ACATTCTCTCACATAGAGAG GGG Intronic
No off target data available for this crispr