ID: 911094707

View in Genome Browser
Species Human (GRCh38)
Location 1:94045883-94045905
Sequence CGGCCCGCCATGGTTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 320}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911094707_911094718 26 Left 911094707 1:94045883-94045905 CCTTGGGAAACCATGGCGGGCCG 0: 1
1: 0
2: 3
3: 29
4: 320
Right 911094718 1:94045932-94045954 GGGTCCCTTGGAGGAGAGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 325
911094707_911094717 25 Left 911094707 1:94045883-94045905 CCTTGGGAAACCATGGCGGGCCG 0: 1
1: 0
2: 3
3: 29
4: 320
Right 911094717 1:94045931-94045953 CGGGTCCCTTGGAGGAGAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 147
911094707_911094711 5 Left 911094707 1:94045883-94045905 CCTTGGGAAACCATGGCGGGCCG 0: 1
1: 0
2: 3
3: 29
4: 320
Right 911094711 1:94045911-94045933 TCCTCTCAGCAGATGGCGCTCGG No data
911094707_911094713 6 Left 911094707 1:94045883-94045905 CCTTGGGAAACCATGGCGGGCCG 0: 1
1: 0
2: 3
3: 29
4: 320
Right 911094713 1:94045912-94045934 CCTCTCAGCAGATGGCGCTCGGG No data
911094707_911094714 14 Left 911094707 1:94045883-94045905 CCTTGGGAAACCATGGCGGGCCG 0: 1
1: 0
2: 3
3: 29
4: 320
Right 911094714 1:94045920-94045942 CAGATGGCGCTCGGGTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 88
911094707_911094710 -2 Left 911094707 1:94045883-94045905 CCTTGGGAAACCATGGCGGGCCG 0: 1
1: 0
2: 3
3: 29
4: 320
Right 911094710 1:94045904-94045926 CGTGTTCTCCTCTCAGCAGATGG 0: 1
1: 0
2: 2
3: 21
4: 140
911094707_911094716 24 Left 911094707 1:94045883-94045905 CCTTGGGAAACCATGGCGGGCCG 0: 1
1: 0
2: 3
3: 29
4: 320
Right 911094716 1:94045930-94045952 TCGGGTCCCTTGGAGGAGAGTGG No data
911094707_911094715 17 Left 911094707 1:94045883-94045905 CCTTGGGAAACCATGGCGGGCCG 0: 1
1: 0
2: 3
3: 29
4: 320
Right 911094715 1:94045923-94045945 ATGGCGCTCGGGTCCCTTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911094707 Original CRISPR CGGCCCGCCATGGTTTCCCA AGG (reversed) Intronic