ID: 911094708

View in Genome Browser
Species Human (GRCh38)
Location 1:94045893-94045915
Sequence GAGGAGAACACGGCCCGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911094708_911094711 -5 Left 911094708 1:94045893-94045915 CCATGGCGGGCCGTGTTCTCCTC No data
Right 911094711 1:94045911-94045933 TCCTCTCAGCAGATGGCGCTCGG No data
911094708_911094721 25 Left 911094708 1:94045893-94045915 CCATGGCGGGCCGTGTTCTCCTC No data
Right 911094721 1:94045941-94045963 GGAGGAGAGTGGGGCGCCTGCGG No data
911094708_911094715 7 Left 911094708 1:94045893-94045915 CCATGGCGGGCCGTGTTCTCCTC No data
Right 911094715 1:94045923-94045945 ATGGCGCTCGGGTCCCTTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 55
911094708_911094717 15 Left 911094708 1:94045893-94045915 CCATGGCGGGCCGTGTTCTCCTC No data
Right 911094717 1:94045931-94045953 CGGGTCCCTTGGAGGAGAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 147
911094708_911094713 -4 Left 911094708 1:94045893-94045915 CCATGGCGGGCCGTGTTCTCCTC No data
Right 911094713 1:94045912-94045934 CCTCTCAGCAGATGGCGCTCGGG No data
911094708_911094716 14 Left 911094708 1:94045893-94045915 CCATGGCGGGCCGTGTTCTCCTC No data
Right 911094716 1:94045930-94045952 TCGGGTCCCTTGGAGGAGAGTGG No data
911094708_911094714 4 Left 911094708 1:94045893-94045915 CCATGGCGGGCCGTGTTCTCCTC No data
Right 911094714 1:94045920-94045942 CAGATGGCGCTCGGGTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 88
911094708_911094718 16 Left 911094708 1:94045893-94045915 CCATGGCGGGCCGTGTTCTCCTC No data
Right 911094718 1:94045932-94045954 GGGTCCCTTGGAGGAGAGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911094708 Original CRISPR GAGGAGAACACGGCCCGCCA TGG (reversed) Intronic