ID: 911094709

View in Genome Browser
Species Human (GRCh38)
Location 1:94045903-94045925
Sequence CATCTGCTGAGAGGAGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911094709_911094717 5 Left 911094709 1:94045903-94045925 CCGTGTTCTCCTCTCAGCAGATG No data
Right 911094717 1:94045931-94045953 CGGGTCCCTTGGAGGAGAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 147
911094709_911094714 -6 Left 911094709 1:94045903-94045925 CCGTGTTCTCCTCTCAGCAGATG No data
Right 911094714 1:94045920-94045942 CAGATGGCGCTCGGGTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 88
911094709_911094715 -3 Left 911094709 1:94045903-94045925 CCGTGTTCTCCTCTCAGCAGATG No data
Right 911094715 1:94045923-94045945 ATGGCGCTCGGGTCCCTTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 55
911094709_911094721 15 Left 911094709 1:94045903-94045925 CCGTGTTCTCCTCTCAGCAGATG No data
Right 911094721 1:94045941-94045963 GGAGGAGAGTGGGGCGCCTGCGG No data
911094709_911094718 6 Left 911094709 1:94045903-94045925 CCGTGTTCTCCTCTCAGCAGATG No data
Right 911094718 1:94045932-94045954 GGGTCCCTTGGAGGAGAGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 325
911094709_911094716 4 Left 911094709 1:94045903-94045925 CCGTGTTCTCCTCTCAGCAGATG No data
Right 911094716 1:94045930-94045952 TCGGGTCCCTTGGAGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911094709 Original CRISPR CATCTGCTGAGAGGAGAACA CGG (reversed) Intronic