ID: 911094715

View in Genome Browser
Species Human (GRCh38)
Location 1:94045923-94045945
Sequence ATGGCGCTCGGGTCCCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911094709_911094715 -3 Left 911094709 1:94045903-94045925 CCGTGTTCTCCTCTCAGCAGATG No data
Right 911094715 1:94045923-94045945 ATGGCGCTCGGGTCCCTTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 55
911094708_911094715 7 Left 911094708 1:94045893-94045915 CCATGGCGGGCCGTGTTCTCCTC No data
Right 911094715 1:94045923-94045945 ATGGCGCTCGGGTCCCTTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 55
911094707_911094715 17 Left 911094707 1:94045883-94045905 CCTTGGGAAACCATGGCGGGCCG 0: 1
1: 0
2: 3
3: 29
4: 320
Right 911094715 1:94045923-94045945 ATGGCGCTCGGGTCCCTTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911094715 Original CRISPR ATGGCGCTCGGGTCCCTTGG AGG Intronic