ID: 911096113

View in Genome Browser
Species Human (GRCh38)
Location 1:94056486-94056508
Sequence ACCTTAGGTCAAAGGCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911096107_911096113 11 Left 911096107 1:94056452-94056474 CCCCTGTACATTTTAGCCTCACG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 911096113 1:94056486-94056508 ACCTTAGGTCAAAGGCAAAGTGG 0: 1
1: 0
2: 1
3: 12
4: 137
911096105_911096113 21 Left 911096105 1:94056442-94056464 CCCACTTTTGCCCCTGTACATTT 0: 1
1: 0
2: 2
3: 27
4: 250
Right 911096113 1:94056486-94056508 ACCTTAGGTCAAAGGCAAAGTGG 0: 1
1: 0
2: 1
3: 12
4: 137
911096106_911096113 20 Left 911096106 1:94056443-94056465 CCACTTTTGCCCCTGTACATTTT 0: 1
1: 0
2: 4
3: 43
4: 313
Right 911096113 1:94056486-94056508 ACCTTAGGTCAAAGGCAAAGTGG 0: 1
1: 0
2: 1
3: 12
4: 137
911096109_911096113 9 Left 911096109 1:94056454-94056476 CCTGTACATTTTAGCCTCACGTG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 911096113 1:94056486-94056508 ACCTTAGGTCAAAGGCAAAGTGG 0: 1
1: 0
2: 1
3: 12
4: 137
911096110_911096113 -5 Left 911096110 1:94056468-94056490 CCTCACGTGAACTTTTTAACCTT 0: 1
1: 0
2: 0
3: 6
4: 142
Right 911096113 1:94056486-94056508 ACCTTAGGTCAAAGGCAAAGTGG 0: 1
1: 0
2: 1
3: 12
4: 137
911096108_911096113 10 Left 911096108 1:94056453-94056475 CCCTGTACATTTTAGCCTCACGT 0: 1
1: 0
2: 0
3: 10
4: 113
Right 911096113 1:94056486-94056508 ACCTTAGGTCAAAGGCAAAGTGG 0: 1
1: 0
2: 1
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911096113 Original CRISPR ACCTTAGGTCAAAGGCAAAG TGG Intronic
900434620 1:2623444-2623466 ACCTGAGGTCAAAGACAATCAGG + Intronic
900600587 1:3501136-3501158 ACCCCAGGTCAAAGGCTCAGGGG + Intronic
900685868 1:3947119-3947141 ACTTGAGATCCAAGGCAAAGGGG + Intergenic
901939139 1:12648765-12648787 AACTTAGGACAGAGGCAGAGAGG - Intronic
902682133 1:18050924-18050946 AACTGAGGTCAAGAGCAAAGTGG + Intergenic
906805039 1:48772513-48772535 ACCATAGGTCTCAGGGAAAGGGG + Intronic
909248075 1:73314530-73314552 ACCTTAAATCAAAGTAAAAGAGG + Intergenic
911096113 1:94056486-94056508 ACCTTAGGTCAAAGGCAAAGTGG + Intronic
912404114 1:109422367-109422389 ACGTTAGGTGAAAGGTAATGAGG - Intronic
914910902 1:151785716-151785738 AGCTTAGGTAAAAGGAAGAGTGG - Intronic
916026315 1:160836667-160836689 ACTTGAGGTCAAGGGCAAGGTGG - Intronic
916792316 1:168136027-168136049 ACCTTTGGACAAAGGCATATGGG - Intronic
917724075 1:177813048-177813070 ACCTCAGGTCAGAGGACAAGAGG + Intergenic
917794323 1:178521794-178521816 ACCTTCATTCAAAGCCAAAGGGG + Intronic
918625363 1:186650986-186651008 CCCAGAAGTCAAAGGCAAAGAGG - Intergenic
924618765 1:245641262-245641284 CACAAAGGTCAAAGGCAAAGAGG - Intronic
1068518833 10:58057063-58057085 ACCCTATGTCAAAGGCCAAATGG - Intergenic
1069239408 10:66121241-66121263 AAATTAGGTCAAAGGCTAATAGG - Intronic
1069281798 10:66663517-66663539 AGCCTAGGTGAAAAGCAAAGTGG - Intronic
1073126689 10:101155113-101155135 ACCTCAGGGCAAAGTCAGAGTGG + Intergenic
1077342159 11:2030997-2031019 GGCCTCGGTCAAAGGCAAAGGGG - Intergenic
1077979022 11:7279961-7279983 ACCTTAGGTGAAGAGCAATGAGG + Intronic
1079277397 11:19054645-19054667 AGATTAGAACAAAGGCAAAGGGG + Exonic
1080777965 11:35403923-35403945 AGCTTAGCTCAAAGGCAAAGAGG + Intronic
1085538449 11:77243059-77243081 ACCTTAAATCTAAGACAAAGGGG + Intronic
1085545151 11:77311375-77311397 ACCCTACGTCAAGGGCTAAGGGG + Intergenic
1087664994 11:101034344-101034366 AGCTCAGGTCACAGGCACAGGGG - Exonic
1089026960 11:115281022-115281044 ACATTAGGTCAAGGCCAGAGGGG - Intronic
1089334994 11:117717122-117717144 ACCCTGGGACAAAGCCAAAGAGG + Intronic
1090464859 11:126925006-126925028 CCCTTAGGGCAAAGGGAAAAGGG + Intronic
1202825145 11_KI270721v1_random:86186-86208 GGCCTCGGTCAAAGGCAAAGGGG - Intergenic
1095258635 12:40071975-40071997 ACCTTAGGAGACAGGAAAAGAGG - Intronic
1096197820 12:49659926-49659948 ACATGGGGTCAAAGGCACAGAGG + Intronic
1101081883 12:101194762-101194784 ATCATAGGTCATAGGCACAGTGG - Intronic
1105728261 13:23186781-23186803 ACCTTATGGCAAAGGCAGAGGGG - Intronic
1106887388 13:34202992-34203014 ACATTAGCTCAAAGGAAAATAGG + Intergenic
1108706719 13:52995370-52995392 ACCTTAAGCCAAAGGCACTGGGG - Intergenic
1109988796 13:70026048-70026070 TCCTGAAGTTAAAGGCAAAGAGG + Intronic
1110365491 13:74680327-74680349 AACATAGGTCAAAGTCAAAAAGG + Intergenic
1111183826 13:84702508-84702530 GCCTGAGGTCAAATGGAAAGAGG + Intergenic
1112083856 13:96006835-96006857 GCCTCAGGACAAAGACAAAGAGG + Intronic
1116505905 14:45681059-45681081 ACTTAAGGTGGAAGGCAAAGGGG + Intergenic
1117964112 14:61189352-61189374 AGTTTAGGGCAAAGGCAAAGGGG + Intronic
1118964510 14:70567402-70567424 CCCTTAGGACAAAGGGAATGTGG + Intergenic
1124188928 15:27554551-27554573 GGCTTAGGAGAAAGGCAAAGTGG + Intergenic
1125251665 15:37712369-37712391 ACCTAGGGCAAAAGGCAAAGTGG - Intergenic
1128300826 15:66565445-66565467 GGCTTAGGGCAAAGGCCAAGTGG + Exonic
1130689789 15:86071970-86071992 ACTTATGGTGAAAGGCAAAGGGG - Intergenic
1133477339 16:6136103-6136125 ACCTAAAGTCAATGGCAAAAAGG - Intronic
1137352178 16:47723100-47723122 GTCTTAGATCAAAGGCCAAGTGG - Intergenic
1137903501 16:52294764-52294786 ATCTTGGGTAAAAGGAAAAGAGG + Intergenic
1140349019 16:74243893-74243915 CCCAGAGGTCAAAAGCAAAGTGG + Intergenic
1140502900 16:75450200-75450222 ACCTCAAGTCAAAGACATAGAGG + Intronic
1143971124 17:10796716-10796738 ACGTTATGCCAATGGCAAAGAGG - Intergenic
1150456397 17:65309980-65310002 ACCTTGTGTCAAGGGCTAAGTGG + Intergenic
1156145827 18:34176464-34176486 CCCATAGGTCAAACTCAAAGAGG + Intronic
1156352718 18:36314832-36314854 ACATTAGGTCAAGGCCTAAGTGG + Intronic
1164007146 19:21160803-21160825 TACTTAGGTGAAAGACAAAGAGG + Intronic
1164322936 19:24167016-24167038 TCCTTATGTAAAAGGGAAAGGGG - Intergenic
1164874677 19:31675598-31675620 ACCTGAGCTCAAAGGCAAATAGG + Intergenic
1165782283 19:38441578-38441600 GCCTTGGATCCAAGGCAAAGGGG + Intronic
925321637 2:2974549-2974571 TCCTTAGGTCAAAGGCAGTGTGG + Intergenic
926365761 2:12131799-12131821 ATCGTAGCTCAAAGGTAAAGTGG + Intergenic
926683935 2:15684142-15684164 CCCTTGGGTCAAAAGAAAAGAGG + Intergenic
927823624 2:26291422-26291444 ACCTTAGGTTGAAGGAAGAGAGG + Intergenic
927882957 2:26701501-26701523 ACCTTAGATCAATGGAAAACCGG + Intronic
930539166 2:52682634-52682656 ATCTAAAGTCAAAGACAAAGAGG + Intergenic
931003546 2:57820001-57820023 ATTTTAGGTGAAAGGCAAAATGG + Intergenic
931311414 2:61084584-61084606 ACCTTAGATAAAGGGAAAAGTGG + Intronic
933461304 2:82589832-82589854 ACTTTATCTCAAAGGCAAAGTGG - Intergenic
933639741 2:84746843-84746865 ACATATGGTGAAAGGCAAAGGGG + Intronic
933640025 2:84748917-84748939 ACATATGGTGAAAGGCAAAGGGG + Intronic
935519370 2:104085078-104085100 ATGTTAGGCCAAAGGAAAAGGGG - Intergenic
936795120 2:116195321-116195343 ACCATGTGTCAAAAGCAAAGGGG + Intergenic
939070442 2:137534140-137534162 AACCTAGATCAAAGGCAAAAGGG - Intronic
942390929 2:175492365-175492387 ACTTGTGGTAAAAGGCAAAGGGG + Intergenic
944285259 2:197942308-197942330 ACGTTTGTTAAAAGGCAAAGGGG - Intronic
944854384 2:203752574-203752596 ACCTTAGATCAAATGCCAATGGG + Intergenic
948200396 2:236125823-236125845 CCCTTAGGTTAAAAGCAAACGGG + Exonic
948489179 2:238300899-238300921 TCTTGAGGTCAAAGGCCAAGAGG + Intergenic
1170040157 20:12031915-12031937 ACCTAAGGTCAAATACTAAGTGG - Intergenic
1170070253 20:12358501-12358523 ACCTTGGGTAAAAGGCAATGTGG + Intergenic
1173554163 20:43953732-43953754 ACCTTAGGACCAAGAGAAAGAGG + Intronic
1175453282 20:59089193-59089215 AGCCAAGGTCAAGGGCAAAGAGG + Intergenic
1178618846 21:34156934-34156956 AACTTAGAACTAAGGCAAAGTGG + Intergenic
1178981158 21:37266846-37266868 ACCTTAGGAGAGAGGGAAAGGGG + Intronic
1181388707 22:22563696-22563718 ACCACAGGTCCAAGACAAAGTGG + Exonic
1181912970 22:26255204-26255226 TCCTTAGGTCATAGGAAAAATGG - Intronic
1182958221 22:34447273-34447295 GCCCAAGGTCAAAAGCAAAGAGG - Intergenic
950123188 3:10495341-10495363 CTCTTAGGTCCAATGCAAAGGGG + Intronic
950236364 3:11324667-11324689 CCCTAAGGACAAAGGCAATGGGG - Intronic
950524663 3:13516827-13516849 ACCTAAGGTCAAAGGAAAGTGGG - Intergenic
951888242 3:27545421-27545443 AGATTAGGCCAAAGGCAAAAAGG + Intergenic
953013579 3:39051943-39051965 ACCCTTGGCCAAAGGGAAAGGGG + Intergenic
953570022 3:44063890-44063912 ATCTTAGGCTAAAGGAAAAGGGG + Intergenic
953687974 3:45093268-45093290 ACCTTATTTCAAAGGTAAGGGGG - Exonic
955783725 3:62513735-62513757 GGCTTAGGTCAGAGGTAAAGAGG + Intronic
956230504 3:67010744-67010766 ACCTTAAGTAAAAGGCACAATGG + Exonic
959140532 3:102481211-102481233 AGCTTTAGTCAAAGGCAATGCGG + Intergenic
959531708 3:107440883-107440905 ACTTGAGGTCAAAGGAAAATAGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
961566952 3:127770754-127770776 ACCTTGGATCACAGGCCAAGTGG - Intronic
965549327 3:169948134-169948156 ACCTTGGCTCACAGGAAAAGAGG + Intergenic
968325250 3:197808192-197808214 AGATTAGGACAAAGACAAAGAGG + Intronic
968623215 4:1613896-1613918 ACCTCAGGTCCCACGCAAAGAGG + Intergenic
969118999 4:4893222-4893244 ACATTAGGTTCATGGCAAAGGGG + Intergenic
971012129 4:22449758-22449780 ACCTTAAGCCTAAGGCTAAGCGG + Intronic
972028490 4:34419126-34419148 ATTTTAGGTCAAAGCCATAGAGG - Intergenic
979455347 4:120921496-120921518 TCTTTAGGTCAGAGGCAAAGGGG + Intronic
981278411 4:142928869-142928891 ACCAAAGGACAAAGGCAAACTGG + Intergenic
982907843 4:161099745-161099767 ACCTTTGGTCATAAGAAAAGTGG - Intergenic
985350203 4:189052820-189052842 ACATGAGGTTAAAGGCAAATAGG + Intergenic
986941362 5:12954126-12954148 ACCTAAGGTGCAAGACAAAGTGG - Intergenic
990799467 5:59584149-59584171 ACAGTAGGACAAAGGGAAAGAGG + Intronic
991561065 5:67953664-67953686 ACATAAGGTTAAAGACAAAGAGG - Intergenic
993060931 5:83038196-83038218 ACCTTAGGTCTGGGGGAAAGTGG + Intergenic
993619724 5:90153620-90153642 ACCAGATCTCAAAGGCAAAGTGG + Intergenic
993804717 5:92391138-92391160 ATATCAGTTCAAAGGCAAAGTGG + Intergenic
998357786 5:141555692-141555714 ACCTTAGCACAAAGGAAAAGAGG + Intronic
999642105 5:153682252-153682274 ACCTGAGGGCAACTGCAAAGGGG + Intronic
1003888408 6:10541745-10541767 AAACTAGCTCAAAGGCAAAGAGG - Intronic
1012502514 6:99904695-99904717 ACCTTATGTCTGAGCCAAAGAGG + Intergenic
1013402473 6:109812302-109812324 AGCCTGGGTCAAAGGCACAGAGG + Intronic
1015283121 6:131455315-131455337 TCCTAAGGTGAAAGGCAAACTGG + Intergenic
1016198784 6:141380815-141380837 ATCTTATTTCTAAGGCAAAGAGG - Intergenic
1016301170 6:142633443-142633465 ACCCTAGCTCATGGGCAAAGTGG + Intergenic
1023841946 7:44103096-44103118 ACCTGGGGTCAAAAGGAAAGAGG - Intergenic
1026993002 7:74598295-74598317 CTCTCAGGTCAAAGGCAGAGAGG + Intronic
1028108741 7:86912979-86913001 ACATCAGGTCTATGGCAAAGAGG - Exonic
1029357806 7:100065708-100065730 AGCTTAGGTCATAGGCAGAAGGG - Intronic
1029442138 7:100592779-100592801 ACCTTGGGTCCGAGGCAAACTGG - Exonic
1032479320 7:132233864-132233886 ACCTTAGGTGAGAGGTAAAAAGG + Intronic
1037624458 8:20595115-20595137 TCTTTAGGTCAAAGCCAAAGGGG - Intergenic
1037729739 8:21514431-21514453 CCCTAAGGTCAATTGCAAAGAGG - Intergenic
1041164656 8:55079332-55079354 ATCTTAGGCTAAAGGAAAAGGGG - Intergenic
1041239534 8:55837654-55837676 CCCTTAGGTCTAAGGCATAGAGG - Intergenic
1045144169 8:99320898-99320920 ACCAAAGGTCAAAGGCAAGCAGG - Intronic
1047164884 8:122426656-122426678 ACAGTAGATGAAAGGCAAAGAGG + Intergenic
1047180309 8:122581521-122581543 ACATTAAGACAAAGGAAAAGAGG - Intergenic
1056734389 9:89194588-89194610 ACTTAAGGCCAAAGGCAAAGAGG + Intergenic
1056810556 9:89760591-89760613 ACATTAGGTCAGAGGCAAGCAGG - Intergenic
1059476783 9:114553773-114553795 GCCTTAGGGAAAAGACAAAGGGG - Intergenic
1061334978 9:129927112-129927134 ACATGAGGTCAAATGGAAAGGGG + Intronic
1061484684 9:130914348-130914370 ACCTTAGGGCAAAGGAACAGAGG + Intronic
1061659677 9:132120692-132120714 TCCTTAGGTCCCAGGCCAAGTGG - Intergenic
1185589257 X:1263051-1263073 ACCTTAGCTCTTAGGGAAAGGGG - Intergenic
1186652442 X:11575476-11575498 TCCTTAGGTAACAGACAAAGAGG + Intronic
1187750449 X:22458121-22458143 ACTTTGGCTCAAATGCAAAGAGG + Intergenic
1188771084 X:34155417-34155439 ACTTTTGGTCCAAGGCTAAGGGG + Intergenic
1192041235 X:67623990-67624012 ACATCAGGTGAAAGGCTAAGGGG + Intronic
1193313080 X:80030569-80030591 AACATAGGTGAAAAGCAAAGTGG - Exonic