ID: 911099664

View in Genome Browser
Species Human (GRCh38)
Location 1:94085051-94085073
Sequence CTGTAGCAATTGGGGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911099658_911099664 14 Left 911099658 1:94085014-94085036 CCACAGGTGGATTTTGATTCTGA 0: 1
1: 0
2: 1
3: 18
4: 206
Right 911099664 1:94085051-94085073 CTGTAGCAATTGGGGGAAAGTGG 0: 1
1: 1
2: 1
3: 15
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911099664 Original CRISPR CTGTAGCAATTGGGGGAAAG TGG Intronic
900631527 1:3638817-3638839 CCGCAGCTGTTGGGGGAAAGGGG + Exonic
901723266 1:11217709-11217731 CTGTAAAAATTTGGGGAAGGGGG - Intronic
904109103 1:28111390-28111412 CTGTGGTAAGTGGGGGAAAGAGG - Intergenic
904357836 1:29952672-29952694 TTGTAACTATTGGGGGAAACTGG + Intergenic
905784706 1:40745187-40745209 CTCTTTCAATTTGGGGAAAGAGG + Intronic
906078326 1:43068165-43068187 CTGTTCCCTTTGGGGGAAAGGGG + Intergenic
909050271 1:70758173-70758195 ATGAAGCAAATGGGGCAAAGAGG + Intergenic
909633396 1:77790076-77790098 ATGTAACCATTGGGGGAAATGGG - Intronic
909951320 1:81723300-81723322 CAGTTGCATTTGGGGGAGAGAGG - Intronic
911099664 1:94085051-94085073 CTGTAGCAATTGGGGGAAAGTGG + Intronic
915311492 1:155007834-155007856 CAGCAGCTGTTGGGGGAAAGGGG + Intronic
915864307 1:159482171-159482193 CTGTAGCTTTGGGGGGGAAGTGG + Intergenic
916628311 1:166583746-166583768 CTGTAGCAATGTGGGAAAAGAGG - Intergenic
917759239 1:178137371-178137393 ATGCAGTAATTGGGAGAAAGAGG - Intronic
919139540 1:193553522-193553544 CTGTAGGAATTGGGAGCAAGGGG - Intergenic
919256179 1:195128189-195128211 CTGTACCAAATGGGAGAAATTGG + Intergenic
921340928 1:214133562-214133584 ATGTAACCATTGGGGGAAACTGG - Intergenic
922945944 1:229514087-229514109 CGGTAACAACTGGGGGAAATTGG - Intergenic
924548168 1:245049846-245049868 CGGTAGCAAATGGTGGAAACGGG - Intronic
924833814 1:247628309-247628331 CTGTGGAAAATGGGGGGAAGAGG - Intergenic
1063422596 10:5925225-5925247 TTGTAGGAAAAGGGGGAAAGAGG - Intronic
1064882194 10:20068225-20068247 CTGTGGCAACCGGGGGTAAGTGG + Exonic
1065941281 10:30566196-30566218 TTGAGGGAATTGGGGGAAAGTGG - Intergenic
1068818102 10:61341305-61341327 ATGTACCAATTGGGGGAATTGGG + Intergenic
1069571568 10:69497548-69497570 ATGGAGAAATAGGGGGAAAGTGG - Intronic
1069758335 10:70788024-70788046 CTGTATCAATTTGGGGAGAATGG + Intergenic
1069940545 10:71952360-71952382 GTGTAGGAATAGGGGGAGAGCGG + Intergenic
1070745321 10:78930246-78930268 CTGTAACCATTGGGGGAAAGTGG + Intergenic
1076131552 10:128017304-128017326 CTATAGAAATTGGAGGTAAGAGG + Intronic
1076315251 10:129535242-129535264 CTGTGGCAATGGGAGGACAGAGG + Intronic
1078686694 11:13538644-13538666 CTGTTCCAAATGGGAGAAAGTGG - Intergenic
1079346925 11:19660872-19660894 CTCTAAAAATTGAGGGAAAGTGG + Intronic
1079994448 11:27280950-27280972 TTATAGCAATTGGTTGAAAGAGG + Intergenic
1080413060 11:32044512-32044534 CTCAAGCATTTGGGGGCAAGAGG + Intronic
1081883716 11:46476682-46476704 GTGAAGCAACTGGGGAAAAGTGG - Intronic
1082165991 11:48951609-48951631 CTGTAACAATTATTGGAAAGAGG + Intergenic
1084175254 11:67419464-67419486 CTGCAGCAAGGAGGGGAAAGGGG - Intronic
1085237219 11:75024336-75024358 CTGCAGAAACTGAGGGAAAGTGG + Intergenic
1086002153 11:81996767-81996789 AAGTACCAATTGGGAGAAAGTGG + Intergenic
1086280734 11:85184575-85184597 CTGTACCAAATGAGGGAAATGGG - Intronic
1088147638 11:106701706-106701728 CTGTAGCACTTGGGGTGAATAGG + Intronic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089204194 11:116745744-116745766 CTGGAGAAGTTAGGGGAAAGTGG + Intergenic
1089571283 11:119412213-119412235 ATGTTGCCATTGGGGGAAACTGG - Intergenic
1090121689 11:124036151-124036173 CTGTTACCATTGGGGGAAACTGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093230471 12:16537136-16537158 CTGTTCCAAATGGGGGAAATTGG + Intronic
1093642946 12:21549188-21549210 CTGTAGTAAGTGGGAGAAATAGG - Intronic
1096332202 12:50723489-50723511 GTGAAGGAACTGGGGGAAAGTGG + Intronic
1097330002 12:58322824-58322846 CAGTAGCAATTGTGAGAATGTGG - Intergenic
1099536897 12:83856203-83856225 CTGTTCCAAATGGGAGAAAGTGG - Intergenic
1100828067 12:98493239-98493261 ATGTGGCAATTTGGGAAAAGTGG - Intronic
1102015544 12:109645651-109645673 CTTTGACAAATGGGGGAAAGAGG - Intergenic
1103210373 12:119161615-119161637 CAATAGCAATTCAGGGAAAGAGG - Exonic
1106414887 13:29538268-29538290 GTTTAGCAAGTGGGGCAAAGTGG + Intronic
1107226344 13:38053077-38053099 CTTTTGCATTTGGGGGAAAGTGG + Intergenic
1108656752 13:52540928-52540950 CTGTCGGGGTTGGGGGAAAGGGG - Intergenic
1108802592 13:54117359-54117381 ATGGTGTAATTGGGGGAAAGGGG + Intergenic
1110069919 13:71161996-71162018 CTGTAGCATTTTAGGGACAGTGG - Intergenic
1110418614 13:75279358-75279380 CTGCAGGGATTGGGGAAAAGGGG + Intergenic
1110970723 13:81757993-81758015 CTGTACCAAATGGGAGAAATTGG + Intergenic
1111385540 13:87521959-87521981 CTGTTGCAAATGGGAGAAATTGG - Intergenic
1111404584 13:87785868-87785890 CTGTAGCAACCAAGGGAAAGGGG + Intergenic
1114093764 14:19311991-19312013 GTGTAGCCAGTGGGGGGAAGTGG - Intergenic
1114260465 14:21032907-21032929 ATGTAACCATTGGGGGAAACTGG - Exonic
1114989099 14:28264619-28264641 CTTTAGCAATAATGGGAAAGGGG + Intergenic
1115747080 14:36448941-36448963 CAGTAGTAATTGGGAGGAAGAGG + Intergenic
1116611376 14:47077196-47077218 CTGTAGCCATTTAGTGAAAGGGG - Intronic
1118108446 14:62688414-62688436 ATGTAACTATTGGGGGAAAATGG + Intergenic
1118159461 14:63274062-63274084 CCTTAGCCATTGGGGGAAAGCGG - Intronic
1119812641 14:77535532-77535554 CAGTAGCAAGTGGTAGAAAGTGG + Intronic
1122359225 14:101149488-101149510 CTGTTGCTTTTGGGGGAGAGGGG + Intergenic
1122706715 14:103626465-103626487 CTGGAGCACTGGGGGGAATGGGG + Intronic
1129935053 15:79440358-79440380 CTGAAGCAAATGGGAGAAATGGG + Intronic
1131084682 15:89566458-89566480 GAGTAGGAGTTGGGGGAAAGAGG - Intergenic
1136914488 16:34171150-34171172 ATTTAGCAATTTGGCGAAAGTGG + Intergenic
1137311678 16:47267026-47267048 CTGAGGGAATTGGAGGAAAGGGG + Intronic
1139070872 16:63381025-63381047 CTGTTGCCATTGGTGAAAAGTGG + Intergenic
1139209765 16:65065756-65065778 CTGTAGCAGCTGTGTGAAAGAGG - Intronic
1140325408 16:73996591-73996613 CTGTAGCTGTTGGGGAAGAGAGG + Intergenic
1142009942 16:87708860-87708882 CAGCAGCAGTTGGGGTAAAGGGG + Intronic
1142827038 17:2519898-2519920 CAGTAGAAATTGTGGGAAGGAGG - Intergenic
1145914447 17:28563325-28563347 CTGTAGCAAATGGAAGAAATGGG + Intronic
1146575167 17:33984608-33984630 CCTTCACAATTGGGGGAAAGAGG + Intronic
1147381610 17:40059699-40059721 CTCTAGCAGTTTGGGGAAACAGG - Intronic
1148622816 17:49047121-49047143 CTAGAGCAATTGGGGCAAACTGG + Intronic
1149809162 17:59650711-59650733 ATGTAGCCATTGGGAGAAACTGG - Intronic
1152111112 17:78358295-78358317 CTGTAGCTCTGGGGGGAAAGAGG - Exonic
1155576000 18:27247669-27247691 CTATATCAGTTGGGGTAAAGCGG - Intergenic
1156378081 18:36532416-36532438 CTGTGGCACCTGGGGGACAGGGG + Intronic
1158020518 18:52836487-52836509 CTGTTCCAAATGGGAGAAAGTGG + Intronic
1158888302 18:61849473-61849495 GTGTGGCTGTTGGGGGAAAGAGG - Intronic
1159532184 18:69669062-69669084 CTTTAGCAATTGGGTGGTAGAGG - Intronic
1159929861 18:74299336-74299358 ATGTAACCATTGGGGGAAACTGG - Intergenic
1160184653 18:76666152-76666174 ATGTAACAATTGGGAGAAACTGG + Intergenic
1160363758 18:78306863-78306885 CCATAGCAATGGGGGAAAAGAGG + Intergenic
1160442897 18:78906063-78906085 CTACAGCCATTGTGGGAAAGAGG + Intergenic
1160859916 19:1233398-1233420 CTGTAGCACCTGGTGGAGAGTGG - Intronic
1162783105 19:13017424-13017446 CTGAAGCAATTGCAAGAAAGAGG + Intronic
1164307745 19:24019737-24019759 CTGGAGGAATGGGGAGAAAGGGG + Intergenic
1164572401 19:29383914-29383936 CTGGAGCTAGTGGTGGAAAGTGG - Intergenic
1165834467 19:38745680-38745702 CTGGAGCCATTGGAGGAAATGGG + Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
927392284 2:22609012-22609034 CTGGAGATATTAGGGGAAAGGGG + Intergenic
927910567 2:26895715-26895737 CTGGAGTAGTTGGGGTAAAGGGG - Intronic
929975470 2:46630067-46630089 CTTAAGTAATTGGGGTAAAGAGG - Intergenic
929989188 2:46770590-46770612 CTGTAGCACTTGGGGAAGAATGG + Intergenic
931928500 2:67101781-67101803 CTGTACCTATTTGGTGAAAGTGG - Intergenic
933820193 2:86104253-86104275 CAGTAGCAATTGGGAGAAAAAGG + Intronic
934135938 2:88996596-88996618 CTTTAGCAATTGTGGAAATGTGG + Intergenic
934234379 2:90217177-90217199 CTTTAGCAATTGTGGAAATGTGG - Intergenic
935430980 2:102975412-102975434 CTTTAACTAATGGGGGAAAGAGG - Intergenic
935730829 2:106063923-106063945 TGGTAGCAATTTGGGGTAAGGGG + Intronic
937108890 2:119346902-119346924 GTGTTGCCAATGGGGGAAAGTGG + Intronic
938325645 2:130397927-130397949 CTAGAGCAATTAGGGGAAAAAGG + Intergenic
938423314 2:131162270-131162292 CTAGAGCAATTAGGGGAAAAAGG - Intronic
938920695 2:135992048-135992070 CAGTAGGAAGTTGGGGAAAGAGG + Intergenic
943184775 2:184593975-184593997 CTGTAGAAATTGTGGAAATGTGG - Intergenic
944534024 2:200692290-200692312 TTGCAGCGATTGGGGGAAAACGG - Intergenic
944915459 2:204356497-204356519 ATTTATCAATTGGAGGAAAGTGG + Intergenic
945799681 2:214411856-214411878 CTGTAGCAATATGGGGAGGGGGG + Intronic
946816737 2:223586456-223586478 CTGCAGCTATTTTGGGAAAGTGG - Intergenic
1170053435 20:12172340-12172362 CTGTAGCAATTGGCTGAAAATGG - Intergenic
1171806477 20:29684951-29684973 CTATAGCAGTTGGGGGTAAATGG - Intergenic
1171837573 20:30171446-30171468 CTATAGCAGTTGGGGGTAAATGG + Intergenic
1171855926 20:30343358-30343380 CTATAGCAGTTGGGGGTAAATGG + Intergenic
1173795261 20:45855293-45855315 CTGTAGGGAGAGGGGGAAAGAGG + Intronic
1176347256 21:5760689-5760711 ATAGAGCAACTGGGGGAAAGGGG + Intergenic
1176354070 21:5881273-5881295 ATAGAGCAACTGGGGGAAAGGGG + Intergenic
1176497571 21:7563766-7563788 ATAGAGCAACTGGGGGAAAGGGG - Intergenic
1176541577 21:8158759-8158781 ATAGAGCAACTGGGGGAAAGGGG + Intergenic
1176560528 21:8341804-8341826 ATAGAGCAACTGGGGGAAAGGGG + Intergenic
1178407207 21:32334657-32334679 CTTGTGCAAATGGGGGAAAGAGG + Intronic
1179078195 21:38143746-38143768 CTGGAGGAAGTGGGGTAAAGAGG + Intronic
1180486972 22:15810584-15810606 GTGTAGCCAGTGGGGGGAAGTGG + Intergenic
1180573962 22:16755523-16755545 CTATAGCAGTTGGGGGTAAATGG + Intergenic
1181237574 22:21456951-21456973 CTGTTGCAATTGGGGATGAGTGG + Intergenic
1182739609 22:32558180-32558202 CTGGAGCAAGTGAGGGAATGAGG + Intronic
1184074105 22:42165174-42165196 CTGGACCAGTTTGGGGAAAGGGG + Intronic
1203246516 22_KI270733v1_random:75178-75200 ATAGAGCAACTGGGGGAAAGGGG + Intergenic
950347008 3:12305186-12305208 CAGTAGCAATTGGGAAAGAGAGG - Intronic
950413089 3:12851729-12851751 CTGTTACCATTGGGGGAAACTGG + Intronic
950528721 3:13540118-13540140 TTGAAGCACCTGGGGGAAAGCGG + Intergenic
950578724 3:13849206-13849228 CTGTCACCATTGGGGGAAACTGG + Intronic
950602401 3:14046105-14046127 CTGTAGCTTTTAGGGGATAGAGG + Intronic
950953829 3:17029693-17029715 CTGTAGCAGTTGGGGGAAAGTGG - Intronic
952498501 3:33936876-33936898 CTGCAGCCATTTGGGCAAAGGGG - Intergenic
953384691 3:42499880-42499902 CTGAAGCACTGGGGGGAAGGGGG - Intronic
953464611 3:43108416-43108438 ATGTAACCATTGGGGGAAACTGG + Intergenic
956345491 3:68273294-68273316 CTTTAGCAAGTCGGGGACAGTGG + Intronic
957508191 3:81153618-81153640 CTTTAGCAGTTGGGGGAGTGGGG + Intergenic
957753158 3:84449468-84449490 CTGCAGTAATTGGGGCAGAGAGG + Intergenic
959031751 3:101307956-101307978 CTGTTGCAAATGGGAGAAATTGG + Intronic
963346650 3:144103176-144103198 CTCTAGCAAATGGGAGAATGTGG - Intergenic
963482259 3:145890962-145890984 ATAGAGCAATTGGGGGAAAAGGG - Intergenic
963965027 3:151358173-151358195 CAGTAGCTATTCTGGGAAAGAGG + Intronic
966556874 3:181272340-181272362 CTGTAGCAAGTGGGGGTGAGGGG - Intergenic
969920511 4:10534814-10534836 TTGTTGCTATTGGGGGAAACTGG - Intronic
971221143 4:24706986-24707008 ATGTAGCCATTGGGGGAAACTGG - Intergenic
973830322 4:54752881-54752903 CAGTAACACTTGGAGGAAAGAGG + Intergenic
973979696 4:56297695-56297717 CTTTAGCAATTTCGGGAAAATGG - Intronic
978860429 4:113442395-113442417 CTATAGCATTTGGAGGACAGGGG - Intergenic
978989387 4:115060020-115060042 ATGTAGCAATATGGGGACAGTGG - Intronic
981120914 4:141050540-141050562 CTGTTGCAAATGGGAGAAAATGG + Intronic
983327477 4:166275171-166275193 CTGTTGGAATTGAGGGAATGAGG + Intergenic
984936767 4:184896893-184896915 CTGCAGGGGTTGGGGGAAAGGGG + Intergenic
984941463 4:184935802-184935824 ATGTAGCCATTGGAGGAAACTGG + Intergenic
986889644 5:12286033-12286055 CTGAAGCCATTGGGGGATTGTGG + Intergenic
986890548 5:12299557-12299579 CTGTACCAATTGAGGGATTGTGG - Intergenic
988260350 5:28878729-28878751 TTTTAGCAATTGGAGGAATGTGG - Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
990337166 5:54786222-54786244 CTGTACCCATCAGGGGAAAGTGG + Intergenic
991952925 5:71964246-71964268 ATGTAACCATTGGGGGAAACTGG + Intergenic
993215797 5:85021412-85021434 CTGTTACAAATGGGGGAAATTGG + Intergenic
994222443 5:97211482-97211504 CTGTAGGAGTGGGGGGAATGGGG - Intergenic
994584219 5:101684998-101685020 CTGTTGTAGTTGGGGGAAGGGGG - Intergenic
994886778 5:105574064-105574086 TTGTAACAAGTGGGAGAAAGAGG - Intergenic
996495605 5:124151540-124151562 CTGTTGGAGTTAGGGGAAAGGGG + Intergenic
996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG + Intergenic
997023759 5:130033346-130033368 CTCTGGCAAGTGAGGGAAAGAGG - Intronic
997054278 5:130422126-130422148 CAGTAGCAAATGGGAGAAAATGG + Intergenic
997826838 5:137114016-137114038 CTCTAGCAATTTGGGGGAGGTGG + Intronic
998116299 5:139540237-139540259 ATGTAACCATTGGGGGAAAATGG + Intronic
1000703765 5:164486075-164486097 CTGTAGAAGTTGGGGGAATCAGG - Intergenic
1001966518 5:175913680-175913702 CTGCAGCAAGTAGGGGAAGGAGG + Intergenic
1002472549 5:179445046-179445068 CTGCAGGACTTGGGGGACAGAGG - Intergenic
1002481572 5:179504605-179504627 CTGCAGGACTTGGGGGACAGAGG + Intergenic
1006214437 6:32428119-32428141 ATGTAACCATTGGGGGAAACTGG - Intergenic
1006415616 6:33902056-33902078 CTCTGGGAATTGGGGGAAAAGGG + Intergenic
1006476778 6:34260650-34260672 CTGTTCCAATTGGGAGAAATTGG + Intergenic
1006937007 6:37725597-37725619 CTGCAGCATTTTGAGGAAAGAGG + Intergenic
1009056768 6:58345719-58345741 CTGAAGCAAATGGTGGAAGGAGG + Intergenic
1009234474 6:61105853-61105875 CTGAAGCAAATGGTGGAAGGAGG - Intergenic
1010428839 6:75755333-75755355 CATAAGCAATAGGGGGAAAGTGG - Intronic
1013803999 6:113976637-113976659 CTGTGGGAGTTGGGGGCAAGAGG + Intronic
1015018641 6:128444516-128444538 CTATTGCAATAGAGGGAAAGAGG - Intronic
1015053076 6:128865419-128865441 ATGTATCAATTGAGGGAAAAAGG - Intergenic
1016987974 6:149909345-149909367 CTGTTGCAAATGGGAGAAATTGG - Intergenic
1016988837 6:149915612-149915634 CTGTATCATTTGGAAGAAAGAGG + Intergenic
1017587097 6:155938511-155938533 TTCTAGAAATTGGGGGAAATTGG + Intergenic
1018815452 6:167327019-167327041 GAGTAGGTATTGGGGGAAAGAGG + Intronic
1019661065 7:2224323-2224345 CTGGAGGAATTGGTGGGAAGGGG - Intronic
1023093167 7:36634932-36634954 GTGTAGAAATTGGGGTTAAGTGG + Intronic
1024551507 7:50566279-50566301 CAGGAGCCATTGGAGGAAAGAGG + Intergenic
1025115293 7:56252756-56252778 TTGTAGCAAGTGGGGAGAAGAGG + Intergenic
1025160153 7:56651827-56651849 CTGTCGGGATTGGGGGCAAGGGG - Intergenic
1025286085 7:57662926-57662948 CTATAGCAGTTGGGGGTAAATGG + Intergenic
1025300076 7:57812023-57812045 CTATAGCAGTTGGGGGTAAATGG - Intergenic
1028781608 7:94743900-94743922 CTGCAGCAATTGTGGGTCAGAGG - Intergenic
1029154771 7:98508439-98508461 CTGTAACCACTGGGAGAAAGCGG + Intergenic
1030205711 7:106950504-106950526 CTGGAGCCATGGGGAGAAAGAGG + Intergenic
1030363889 7:108624697-108624719 GTGGAGCCCTTGGGGGAAAGGGG + Intergenic
1030475534 7:110028878-110028900 TTGTTGCCATTGGGGGAAATTGG - Intergenic
1030994348 7:116340247-116340269 GTGTGACAATGGGGGGAAAGCGG - Intronic
1032944868 7:136837784-136837806 ATGTTGCAATTGGGGGCAACTGG + Intergenic
1033455607 7:141500634-141500656 GTTTAGCAATTGGGGAAAAATGG - Intergenic
1033584231 7:142762405-142762427 CTGTGGAGATTGTGGGAAAGAGG + Intronic
1034061876 7:148099568-148099590 CTGCAGCCATTGGGGGAAAAGGG - Intronic
1036059527 8:5300259-5300281 GTGTAGCAATCTGGGGAAAGGGG - Intergenic
1038499098 8:28028607-28028629 CTCTACTACTTGGGGGAAAGGGG + Intronic
1040617687 8:49055194-49055216 CTGTAGCAATTAGGAGCAGGAGG - Intronic
1041025039 8:53675641-53675663 GTGTATCAATTTGGGGAAAATGG - Intergenic
1041522889 8:58774111-58774133 CTGTAGGAATTGATTGAAAGTGG - Intergenic
1041980901 8:63858260-63858282 ATGTAGTCATTGGGGGAAATGGG - Intergenic
1042464926 8:69117847-69117869 CTGTAGCAAATAGGGCAAACTGG - Intergenic
1042693842 8:71533655-71533677 CTTTAGGAAGTGGGGGAGAGAGG - Intronic
1042888397 8:73578599-73578621 CTGAAGCAATTGGGAGCAATGGG - Intronic
1043418924 8:80079289-80079311 CTGTAGAAGTTGGGGGCAGGAGG - Intronic
1046589879 8:116193241-116193263 ATGTAGCAAGAGGGAGAAAGCGG - Intergenic
1047006999 8:120630831-120630853 TTGAAACAATTGGGGCAAAGAGG + Intronic
1047756408 8:127922397-127922419 ATGTAGCATATGGGGGAGAGGGG - Intergenic
1049402682 8:142436693-142436715 CTGTAAAAAATGGGGGAAACTGG - Intergenic
1051562129 9:18453687-18453709 CTGTAGGACTTTGGGGAAGGTGG - Intergenic
1052369031 9:27643947-27643969 AGGTAGCAGTTGGGGGAAAGGGG + Intergenic
1052380720 9:27767856-27767878 CTGTCGGGGTTGGGGGAAAGGGG + Intergenic
1052558018 9:30045102-30045124 ATATTGCCATTGGGGGAAAGTGG + Intergenic
1053471692 9:38350979-38351001 CTGTATCTCTTGGGGGATAGTGG + Intergenic
1053850565 9:42286403-42286425 CTGTCGTGGTTGGGGGAAAGGGG + Intergenic
1057106725 9:92426230-92426252 TTGTAGCAATTGGGGAGAAAAGG + Intronic
1058710136 9:107672093-107672115 CTGTCCCACTTGAGGGAAAGTGG + Intergenic
1058845846 9:108958592-108958614 CTGTTGGAACTGGGGGAAAGAGG - Intronic
1059541409 9:115134041-115134063 CTTTAGCAAATGGGTGAAACAGG + Intergenic
1060447494 9:123704616-123704638 TTGTAGGAATTGGGGGAGTGGGG - Intronic
1203462851 Un_GL000220v1:58240-58262 ATAGAGCAACTGGGGGAAAGGGG + Intergenic
1185507370 X:641139-641161 CGGCAGCAAATAGGGGAAAGGGG - Intronic
1186529822 X:10283965-10283987 CTTTAGCAGTTGGGGCCAAGGGG + Intergenic
1188951904 X:36386701-36386723 CTGTAGCAATTGAGAAAGAGGGG + Intergenic
1190000211 X:46678821-46678843 ATGTAACCATTGGGGGAAACTGG - Intronic
1191266794 X:58403650-58403672 CTGAAGCCATTGGGGGAGAAAGG + Intergenic
1192310207 X:70005609-70005631 GTGTAGGTATTGAGGGAAAGTGG + Intronic
1192813814 X:74571134-74571156 ATGTAGCCATTGGGGGAAACTGG + Intergenic
1192963803 X:76156449-76156471 CTGTGGCTATTTGAGGAAAGTGG + Intergenic
1193813826 X:86082637-86082659 CTGTAGCAATATGGGCAAAAAGG - Intergenic
1194467484 X:94251686-94251708 CTGTAGCCATTTCAGGAAAGTGG - Intergenic
1194739994 X:97561009-97561031 CTGAAGCATCTGGGGGGAAGGGG + Intronic
1195119536 X:101736406-101736428 CAGTAGCAAATCTGGGAAAGAGG + Intergenic
1195404640 X:104499611-104499633 CTGTAGCATTTGGGTGGAGGGGG - Intergenic
1195522684 X:105849637-105849659 CTGTTGCAAATGGGAGAAATTGG + Intronic
1199456462 X:148034889-148034911 ATGTAACTATTGGGGGAAATTGG + Intergenic
1200254343 X:154571764-154571786 CTGGAGGAGTTGGGGGAAAACGG + Intergenic
1200263426 X:154632644-154632666 CTGGAGGAGTTGGGGGAAAACGG - Intergenic