ID: 911099936

View in Genome Browser
Species Human (GRCh38)
Location 1:94087565-94087587
Sequence GAGGCAGCACAGGTGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911099922_911099936 25 Left 911099922 1:94087517-94087539 CCCTCTGCCCTTTGCCTGGTCCC 0: 1
1: 0
2: 3
3: 38
4: 538
Right 911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG No data
911099926_911099936 11 Left 911099926 1:94087531-94087553 CCTGGTCCCTGCCTGCAACATGG 0: 1
1: 0
2: 2
3: 38
4: 359
Right 911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG No data
911099929_911099936 4 Left 911099929 1:94087538-94087560 CCTGCCTGCAACATGGATGTGCT 0: 1
1: 0
2: 2
3: 20
4: 204
Right 911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG No data
911099928_911099936 5 Left 911099928 1:94087537-94087559 CCCTGCCTGCAACATGGATGTGC 0: 1
1: 0
2: 1
3: 17
4: 205
Right 911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG No data
911099923_911099936 24 Left 911099923 1:94087518-94087540 CCTCTGCCCTTTGCCTGGTCCCT 0: 1
1: 0
2: 2
3: 70
4: 604
Right 911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG No data
911099931_911099936 0 Left 911099931 1:94087542-94087564 CCTGCAACATGGATGTGCTGGAG 0: 1
1: 0
2: 0
3: 16
4: 184
Right 911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG No data
911099925_911099936 17 Left 911099925 1:94087525-94087547 CCTTTGCCTGGTCCCTGCCTGCA No data
Right 911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG No data
911099921_911099936 26 Left 911099921 1:94087516-94087538 CCCCTCTGCCCTTTGCCTGGTCC 0: 1
1: 0
2: 3
3: 60
4: 444
Right 911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG No data
911099924_911099936 18 Left 911099924 1:94087524-94087546 CCCTTTGCCTGGTCCCTGCCTGC 0: 1
1: 0
2: 3
3: 49
4: 470
Right 911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911099936 Original CRISPR GAGGCAGCACAGGTGTTTGG AGG Intronic
No off target data available for this crispr