ID: 911100097

View in Genome Browser
Species Human (GRCh38)
Location 1:94088666-94088688
Sequence ATTGGTGCTGGGAATGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911100091_911100097 -4 Left 911100091 1:94088647-94088669 CCAGCCTGGAGATCCAGAAATTG No data
Right 911100097 1:94088666-94088688 ATTGGTGCTGGGAATGAGTGTGG No data
911100089_911100097 11 Left 911100089 1:94088632-94088654 CCATTGTCTAAATCTCCAGCCTG No data
Right 911100097 1:94088666-94088688 ATTGGTGCTGGGAATGAGTGTGG No data
911100086_911100097 17 Left 911100086 1:94088626-94088648 CCCATCCCATTGTCTAAATCTCC 0: 1
1: 0
2: 2
3: 10
4: 169
Right 911100097 1:94088666-94088688 ATTGGTGCTGGGAATGAGTGTGG No data
911100087_911100097 16 Left 911100087 1:94088627-94088649 CCATCCCATTGTCTAAATCTCCA 0: 1
1: 0
2: 1
3: 14
4: 208
Right 911100097 1:94088666-94088688 ATTGGTGCTGGGAATGAGTGTGG No data
911100088_911100097 12 Left 911100088 1:94088631-94088653 CCCATTGTCTAAATCTCCAGCCT 0: 1
1: 0
2: 1
3: 12
4: 155
Right 911100097 1:94088666-94088688 ATTGGTGCTGGGAATGAGTGTGG No data
911100093_911100097 -8 Left 911100093 1:94088651-94088673 CCTGGAGATCCAGAAATTGGTGC 0: 1
1: 0
2: 1
3: 18
4: 170
Right 911100097 1:94088666-94088688 ATTGGTGCTGGGAATGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911100097 Original CRISPR ATTGGTGCTGGGAATGAGTG TGG Intronic