ID: 911104167

View in Genome Browser
Species Human (GRCh38)
Location 1:94117119-94117141
Sequence TTCAATCAACATGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911104160_911104167 -10 Left 911104160 1:94117106-94117128 CCTCTCTTTACCATTCAATCAAC 0: 1
1: 0
2: 1
3: 11
4: 184
Right 911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG No data
911104155_911104167 5 Left 911104155 1:94117091-94117113 CCTCTCACCTCCCCTCCTCTCTT 0: 1
1: 14
2: 263
3: 1555
4: 7588
Right 911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG No data
911104156_911104167 -2 Left 911104156 1:94117098-94117120 CCTCCCCTCCTCTCTTTACCATT No data
Right 911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG No data
911104154_911104167 6 Left 911104154 1:94117090-94117112 CCCTCTCACCTCCCCTCCTCTCT 0: 1
1: 2
2: 61
3: 579
4: 3777
Right 911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG No data
911104153_911104167 21 Left 911104153 1:94117075-94117097 CCTCTCTCTCTCTCTCCCTCTCA 0: 5
1: 214
2: 2909
3: 7628
4: 19508
Right 911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG No data
911104159_911104167 -7 Left 911104159 1:94117103-94117125 CCTCCTCTCTTTACCATTCAATC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG No data
911104157_911104167 -5 Left 911104157 1:94117101-94117123 CCCCTCCTCTCTTTACCATTCAA 0: 1
1: 0
2: 4
3: 58
4: 752
Right 911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG No data
911104158_911104167 -6 Left 911104158 1:94117102-94117124 CCCTCCTCTCTTTACCATTCAAT 0: 1
1: 0
2: 2
3: 40
4: 432
Right 911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911104167 Original CRISPR TTCAATCAACATGGGGAGGA GGG Intronic
No off target data available for this crispr