ID: 911104208

View in Genome Browser
Species Human (GRCh38)
Location 1:94117404-94117426
Sequence CAGCTGTCCCAGGTGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911104200_911104208 11 Left 911104200 1:94117370-94117392 CCTCGGCTTGATGCTGAACCCAG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG No data
911104203_911104208 -7 Left 911104203 1:94117388-94117410 CCCAGGACAAAGGCCACAGCTGT No data
Right 911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG No data
911104204_911104208 -8 Left 911104204 1:94117389-94117411 CCAGGACAAAGGCCACAGCTGTC 0: 1
1: 1
2: 4
3: 33
4: 233
Right 911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG No data
911104199_911104208 17 Left 911104199 1:94117364-94117386 CCACATCCTCGGCTTGATGCTGA 0: 1
1: 0
2: 0
3: 11
4: 121
Right 911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911104208 Original CRISPR CAGCTGTCCCAGGTGCTCCA GGG Intronic
No off target data available for this crispr