ID: 911104437

View in Genome Browser
Species Human (GRCh38)
Location 1:94118745-94118767
Sequence TTCTCCACAGTGTGCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911104437_911104443 22 Left 911104437 1:94118745-94118767 CCCTGGGAGCACACTGTGGAGAA No data
Right 911104443 1:94118790-94118812 CGCCCACCCATGCCAGCGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
911104437_911104440 -4 Left 911104437 1:94118745-94118767 CCCTGGGAGCACACTGTGGAGAA No data
Right 911104440 1:94118764-94118786 AGAAGGCAGAGTCCCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911104437 Original CRISPR TTCTCCACAGTGTGCTCCCA GGG (reversed) Intronic