ID: 911104440

View in Genome Browser
Species Human (GRCh38)
Location 1:94118764-94118786
Sequence AGAAGGCAGAGTCCCTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911104438_911104440 -5 Left 911104438 1:94118746-94118768 CCTGGGAGCACACTGTGGAGAAG 0: 1
1: 0
2: 1
3: 25
4: 253
Right 911104440 1:94118764-94118786 AGAAGGCAGAGTCCCTGAGCAGG No data
911104437_911104440 -4 Left 911104437 1:94118745-94118767 CCCTGGGAGCACACTGTGGAGAA No data
Right 911104440 1:94118764-94118786 AGAAGGCAGAGTCCCTGAGCAGG No data
911104428_911104440 26 Left 911104428 1:94118715-94118737 CCAAGGCCCTCAGCCCGAGTGGC 0: 1
1: 0
2: 3
3: 22
4: 182
Right 911104440 1:94118764-94118786 AGAAGGCAGAGTCCCTGAGCAGG No data
911104433_911104440 12 Left 911104433 1:94118729-94118751 CCGAGTGGCTCCATCTCCCTGGG No data
Right 911104440 1:94118764-94118786 AGAAGGCAGAGTCCCTGAGCAGG No data
911104431_911104440 13 Left 911104431 1:94118728-94118750 CCCGAGTGGCTCCATCTCCCTGG 0: 1
1: 0
2: 2
3: 41
4: 285
Right 911104440 1:94118764-94118786 AGAAGGCAGAGTCCCTGAGCAGG No data
911104430_911104440 19 Left 911104430 1:94118722-94118744 CCTCAGCCCGAGTGGCTCCATCT No data
Right 911104440 1:94118764-94118786 AGAAGGCAGAGTCCCTGAGCAGG No data
911104435_911104440 2 Left 911104435 1:94118739-94118761 CCATCTCCCTGGGAGCACACTGT 0: 1
1: 0
2: 1
3: 36
4: 277
Right 911104440 1:94118764-94118786 AGAAGGCAGAGTCCCTGAGCAGG No data
911104429_911104440 20 Left 911104429 1:94118721-94118743 CCCTCAGCCCGAGTGGCTCCATC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 911104440 1:94118764-94118786 AGAAGGCAGAGTCCCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911104440 Original CRISPR AGAAGGCAGAGTCCCTGAGC AGG Intronic