ID: 911104443

View in Genome Browser
Species Human (GRCh38)
Location 1:94118790-94118812
Sequence CGCCCACCCATGCCAGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911104438_911104443 21 Left 911104438 1:94118746-94118768 CCTGGGAGCACACTGTGGAGAAG 0: 1
1: 0
2: 1
3: 25
4: 253
Right 911104443 1:94118790-94118812 CGCCCACCCATGCCAGCGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
911104437_911104443 22 Left 911104437 1:94118745-94118767 CCCTGGGAGCACACTGTGGAGAA No data
Right 911104443 1:94118790-94118812 CGCCCACCCATGCCAGCGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
911104442_911104443 -10 Left 911104442 1:94118777-94118799 CCTGAGCAGGAGTCGCCCACCCA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 911104443 1:94118790-94118812 CGCCCACCCATGCCAGCGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
911104435_911104443 28 Left 911104435 1:94118739-94118761 CCATCTCCCTGGGAGCACACTGT 0: 1
1: 0
2: 1
3: 36
4: 277
Right 911104443 1:94118790-94118812 CGCCCACCCATGCCAGCGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
911104441_911104443 -9 Left 911104441 1:94118776-94118798 CCCTGAGCAGGAGTCGCCCACCC No data
Right 911104443 1:94118790-94118812 CGCCCACCCATGCCAGCGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911104443 Original CRISPR CGCCCACCCATGCCAGCGAA AGG Intronic