ID: 911111605

View in Genome Browser
Species Human (GRCh38)
Location 1:94193810-94193832
Sequence AAGTGTTACCAGAGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911111600_911111605 23 Left 911111600 1:94193764-94193786 CCAGCAGACCTGCTATAAAATAG 0: 1
1: 0
2: 3
3: 38
4: 502
Right 911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG 0: 1
1: 0
2: 2
3: 33
4: 332
911111599_911111605 29 Left 911111599 1:94193758-94193780 CCATTACCAGCAGACCTGCTATA 0: 1
1: 0
2: 2
3: 23
4: 130
Right 911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG 0: 1
1: 0
2: 2
3: 33
4: 332
911111602_911111605 15 Left 911111602 1:94193772-94193794 CCTGCTATAAAATAGTGGTAAAG 0: 1
1: 0
2: 1
3: 17
4: 174
Right 911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG 0: 1
1: 0
2: 2
3: 33
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911111605 Original CRISPR AAGTGTTACCAGAGGAAAGA TGG Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
906766289 1:48437698-48437720 AAGTATTAACAGAAGAAAAAAGG - Intronic
907698094 1:56754446-56754468 AAGTGTTAGAAGAGTAGAGAAGG - Intronic
907897577 1:58706263-58706285 AAACCTTACCAGAGGAAAAAAGG + Intergenic
908990904 1:70088211-70088233 AAGTGTTACCAAAGGTTAGCAGG - Intronic
909213008 1:72848119-72848141 AAGTGTTACTAGAGAGGAGAGGG + Intergenic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
909501873 1:76343865-76343887 AAGTTTTAACAGAGGAATTATGG + Intronic
910079515 1:83325002-83325024 AAGTTTTCCCAGAGTAAACAAGG - Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
911820658 1:102415680-102415702 TTGTCTTACAAGAGGAAAGAAGG + Intergenic
913113200 1:115674186-115674208 AAGTCTTACAAGATGAATGATGG - Intronic
915155564 1:153873098-153873120 AAATGTTAACACAGGGAAGAAGG + Intronic
916208035 1:162334286-162334308 AAGTGCTACAACTGGAAAGATGG + Intronic
916360789 1:163965562-163965584 AAATGTTATTAGAGCAAAGAGGG + Intergenic
917381732 1:174418240-174418262 ACGTGTTATCTTAGGAAAGAAGG - Intronic
917435060 1:175012519-175012541 AATTGTTAGCAGGGGAAGGAAGG + Intronic
919263194 1:195225216-195225238 AGGTGTTAGCTGAGGAAAGGAGG - Intergenic
919361818 1:196606152-196606174 AACTGTGACAAGAGGAAGGATGG - Intronic
920992093 1:210949231-210949253 ATGTGTTTGCAGAGGACAGAAGG - Intronic
921518247 1:216124829-216124851 AAGGGTTACCAGTGTAAAGAAGG + Intronic
921777629 1:219120577-219120599 AAGTATTAACATAAGAAAGAAGG + Intergenic
921996839 1:221428500-221428522 AAGTGTCACAAGAGAAAACATGG - Intergenic
923163936 1:231341562-231341584 AAGTTTTACTAGAGGAAAAGTGG + Intronic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923854779 1:237834519-237834541 AAGTGATACCAGAAGACAAAAGG - Intergenic
924353621 1:243145957-243145979 AAGTTTTGTAAGAGGAAAGAGGG + Intronic
924481219 1:244436054-244436076 CAGTGTTTCCAGGGGAAAAAAGG - Intronic
1062818593 10:517690-517712 ACGTGTCACCAGCAGAAAGATGG + Intronic
1064704676 10:18059555-18059577 AATTATTATCAGAGGAAAGGAGG - Intergenic
1066094884 10:32062627-32062649 AGGTGGGACCTGAGGAAAGACGG - Intergenic
1066568590 10:36747274-36747296 AAGTGTTATCAGAGGAGATTTGG + Intergenic
1067557928 10:47285362-47285384 AAGGGAGGCCAGAGGAAAGAAGG + Intergenic
1068228313 10:54135670-54135692 ATGTGCTATCAGAGAAAAGAAGG - Intronic
1068387227 10:56347029-56347051 AAGTGATATGAGAGGAAAAAAGG + Intergenic
1069376031 10:67793932-67793954 AAGTGTTACCAGGGCAAAACCGG + Intergenic
1070568945 10:77626393-77626415 AAGTGTTCCCAGATGCAGGAAGG + Intronic
1072143132 10:92608376-92608398 AATTGTTACCATAGGAGATATGG + Intronic
1072158635 10:92746365-92746387 AAGTATTCCAAGAGAAAAGAAGG + Intergenic
1074301350 10:112235749-112235771 TTGTGTTACAAGATGAAAGAGGG - Intergenic
1074571643 10:114629800-114629822 AAGGGTTTCCATAGGAAAAAGGG - Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1078096696 11:8301798-8301820 AGGTGTTTCCAAAGGAAAGGAGG - Intergenic
1078632621 11:13017174-13017196 AAGTGAAACCAAAGGAAAAATGG - Intergenic
1079724503 11:23864338-23864360 AAGTGTTGCCTGATGAAAGCAGG - Intergenic
1080963053 11:37182247-37182269 TACTGTTACCAGAGGAAGGGAGG + Intergenic
1081613501 11:44577380-44577402 AAGTCTTCCCTGAGGGAAGAAGG - Intronic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1083421054 11:62553508-62553530 AACTGTAAGCAGAGGAGAGAGGG - Intronic
1085434660 11:76489496-76489518 AAGGGTTACCAGAGATAAAAAGG - Intronic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1087132689 11:94682191-94682213 TAGGGTTACCAAAGGAGAGAGGG - Intergenic
1087280713 11:96206948-96206970 AAGTGTTACCAGCATAAAAAAGG + Intronic
1087284874 11:96254707-96254729 AAGTCGTTCCAGAGCAAAGATGG + Intronic
1087974516 11:104528416-104528438 AAGTTTTCACAGAGGTAAGAGGG - Intergenic
1089057182 11:115595180-115595202 AAGCCTTACAATAGGAAAGAAGG + Intergenic
1090228176 11:125083974-125083996 AGGTGGCACCAGAGGAAAAATGG + Intronic
1091283777 11:134397014-134397036 AGCTGCTTCCAGAGGAAAGATGG - Intronic
1092069744 12:5623027-5623049 AAGTGTTTCCAGAGGCCAGGTGG + Intronic
1092924134 12:13258435-13258457 ATGTGCTACAAGAGGAAGGAGGG - Intergenic
1096137529 12:49214929-49214951 AAGTGTTAGCTGAGGAAGGAAGG - Intronic
1096417532 12:51426578-51426600 AAATGTTAACTGAGGGAAGAGGG + Intronic
1097162199 12:57055075-57055097 AAGGATTCCCAGAGCAAAGAAGG + Intergenic
1098340812 12:69449202-69449224 AAGTGTCTCCAGAAGAAAGGAGG + Intergenic
1098881915 12:75925994-75926016 AAGTGATTCTAAAGGAAAGAGGG - Intergenic
1099153333 12:79143184-79143206 AATTGTTACCATAGGAACAATGG + Intronic
1099796312 12:87405036-87405058 AAGTGTTCAAAAAGGAAAGAAGG - Intergenic
1100081146 12:90852319-90852341 AAGTTTTATTAAAGGAAAGAGGG + Intergenic
1100596642 12:96077909-96077931 AAGTCTTAACAGAGGCAAGTGGG - Intergenic
1100813005 12:98358569-98358591 AAGTGTTTCATGAGGAGAGAGGG + Intergenic
1103118328 12:118357391-118357413 ACGTGTTAGCAGAAAAAAGATGG - Intronic
1103127089 12:118433010-118433032 AACTATTACCATAGGAAAGCAGG - Intergenic
1106138066 13:26989537-26989559 AACTGTTTCCAGAAGACAGAGGG + Intergenic
1108422895 13:50268757-50268779 AAGTGTTAGCAGAGGAAACTTGG + Intronic
1108805924 13:54156517-54156539 AAGTATTTCCAGAGGAGAGTCGG + Intergenic
1109444149 13:62411314-62411336 AAGTGATCTCAGTGGAAAGAAGG - Intergenic
1110116483 13:71822779-71822801 ATATGATACCAAAGGAAAGAGGG + Intronic
1110177705 13:72577281-72577303 AGGTGTTACAAGAGCATAGAGGG + Intergenic
1110321414 13:74164431-74164453 AAGTGTTAACACATGAAAGTAGG + Intergenic
1110504229 13:76266484-76266506 AGGTATTAGCAGAGGCAAGAAGG - Intergenic
1110520322 13:76468537-76468559 ATGTGTTGCCAAAGGAAAGTGGG - Intergenic
1110694493 13:78472323-78472345 AGATGTCAGCAGAGGAAAGAGGG - Intergenic
1111027875 13:82556136-82556158 AGTGGTTACCAGAGGTAAGAGGG + Intergenic
1111714785 13:91866531-91866553 AAGTATTACATGAGGAGAGAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111905696 13:94253220-94253242 AAGGGTTACAAGAGATAAGAGGG + Intronic
1112211910 13:97386425-97386447 AAGTGCTACCTGCGGAAACATGG - Intronic
1112298304 13:98208513-98208535 CAGTGTTACCAGATGACATATGG - Intronic
1113499605 13:110762968-110762990 AAGTGTTACCATGGCAAAGCTGG - Intergenic
1114007153 14:18326416-18326438 AAGTGTTATCAGAGGAGATTTGG + Intergenic
1114791535 14:25664917-25664939 ACGTGTTCCAAGAGGTAAGATGG + Intergenic
1114822920 14:26043225-26043247 AAGTGTAACCATGGGTAAGAGGG - Intergenic
1115308070 14:31952250-31952272 AGTCATTACCAGAGGAAAGAAGG + Intergenic
1115326138 14:32141061-32141083 AACTGTTACAAGAGCATAGAAGG - Intronic
1115473469 14:33792011-33792033 AACTATTAACAGAGGAACGATGG - Intronic
1115964026 14:38866622-38866644 AAATGATACTAGAGGAAAGGAGG - Intergenic
1116601367 14:46928751-46928773 AAGAGTTACTAAAGGAAGGAAGG - Intronic
1117275970 14:54193898-54193920 AAATGTTATCATAGGAAAGAAGG - Intergenic
1117407030 14:55413875-55413897 AAATGTTACCACAGCAAAGCTGG - Exonic
1118020223 14:61704544-61704566 ACTTGTTAGCAGAGGAAAGTTGG + Intronic
1119348104 14:73942805-73942827 AAGTGTTACTGGAGGCAAGTAGG + Intronic
1119447172 14:74675401-74675423 AAATTTTGGCAGAGGAAAGAAGG - Intronic
1119550413 14:75507318-75507340 AAATGTTACTACAGCAAAGAAGG + Intergenic
1120076433 14:80164106-80164128 AATTGTTTCCAGAAGATAGATGG + Intergenic
1120286332 14:82506486-82506508 AAGTTTAACCAGTGGAAAGTTGG - Intergenic
1120735141 14:88044380-88044402 AAGTGTTAGCAAAGCAAACAGGG + Intergenic
1120783216 14:88505295-88505317 AAGTCTTACCACAGGAAACAAGG + Exonic
1120866505 14:89299741-89299763 AACTGTTGCCAAAGGAAGGAGGG - Intronic
1121364668 14:93297968-93297990 AAGTGTTTCTAAAGGTAAGACGG + Intronic
1121566191 14:94911214-94911236 ATATGTTGCAAGAGGAAAGATGG + Intergenic
1122366026 14:101195276-101195298 ACTTGTTCCCAGAGGAAAGTGGG + Intergenic
1123391070 15:19873058-19873080 AAGTGTTATCAGAGGAGATTTGG + Intergenic
1124249492 15:28097540-28097562 AACTGTTAGTAGTGGAAAGATGG - Intronic
1124424835 15:29555180-29555202 AGGTGTTCCCCGAGGAAAGGGGG - Intronic
1125012462 15:34894532-34894554 AAATGCTACCAGAGGAAACTTGG + Intronic
1125131053 15:36285753-36285775 AATTGTTACCAATGGAAAGAAGG - Intergenic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126406711 15:48330294-48330316 AAGTGTTAAAAGAGATAAGATGG + Intergenic
1126771044 15:52056248-52056270 AAGTGCTACAGCAGGAAAGAGGG - Intronic
1126900043 15:53305457-53305479 AAGTGTTAACAGTGGACAGCTGG + Intergenic
1128369591 15:67030656-67030678 GTGTGTTTCCAAAGGAAAGAGGG + Intergenic
1128920482 15:71605820-71605842 AAGTGTAGACAGAGGAGAGATGG + Intronic
1129935549 15:79446345-79446367 AAGTGAATCCAGAGGAAATAAGG - Intronic
1130155693 15:81348278-81348300 AGGTGTTACAAGAGGAAATGGGG + Intronic
1130437102 15:83911738-83911760 AAGTCTTGCCTGGGGAAAGAAGG + Intronic
1134117693 16:11561473-11561495 AGATGTTACCACATGAAAGATGG - Intronic
1137506222 16:49056223-49056245 AAGTGTTGCCAGGTGGAAGAAGG - Intergenic
1138084029 16:54117319-54117341 AACTGTTACCACAGGAAACTTGG - Exonic
1138206267 16:55127397-55127419 AAGTGATCCAGGAGGAAAGACGG + Intergenic
1138680051 16:58677794-58677816 AAGAGATGCCAGAGGTAAGAGGG + Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139729261 16:68928704-68928726 AAGTTTGAGCAGATGAAAGAGGG + Intronic
1140058469 16:71546410-71546432 ATGTGATAGAAGAGGAAAGACGG - Intronic
1141405983 16:83793551-83793573 TTGTGTTCCCAGAGGAAAAAAGG - Intronic
1141981876 16:87555756-87555778 AAGTGTAACGAGAGGAGGGAGGG - Intergenic
1142595637 17:1028550-1028572 AGGTGTTACCTGAGGAAGGGCGG - Intronic
1143008547 17:3852912-3852934 AAGGCTTCCCAGAGGAAGGAAGG - Intergenic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1147169237 17:38608538-38608560 AAGTGGAGCCAGAGGACAGATGG + Intergenic
1147840977 17:43371238-43371260 GAGAGTTACCAGAGGTAAGGAGG + Intergenic
1148521454 17:48279860-48279882 AACTGTGAGCACAGGAAAGAAGG - Intronic
1152818155 17:82421025-82421047 AGGAGGTAACAGAGGAAAGAGGG + Intronic
1154290489 18:13102153-13102175 AGGAGCTCCCAGAGGAAAGAAGG - Intronic
1154530308 18:15337599-15337621 AAGTGTTATCAGAGGAGATTTGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156179345 18:34584794-34584816 AAGTGTTTTCAGAGAGAAGAAGG + Intronic
1156624468 18:38891833-38891855 AAGTGTTTTCAAAGGAAACAAGG + Intergenic
1157371362 18:47115283-47115305 AGGTATTACAAGAGGAAAGATGG - Exonic
1157404078 18:47409036-47409058 AAATGTCAACAGAGTAAAGAAGG - Intergenic
1157431680 18:47633267-47633289 AACTGGTATCAGAGGACAGAAGG - Intergenic
1157668608 18:49509780-49509802 GAATTTTACAAGAGGAAAGATGG - Intergenic
1158263616 18:55635994-55636016 AAGTGTTACCATGGCAAAGCTGG + Intronic
1158502076 18:58011408-58011430 AAGTGTTTCCATAGGGAACAGGG - Intergenic
1158557725 18:58489133-58489155 AAGAGTTCCTACAGGAAAGATGG + Intronic
1159095378 18:63895707-63895729 AAGGATTTCCAGAGGAGAGAGGG + Intronic
1163951012 19:20586321-20586343 TAGTGTTCCCAGAGAAATGAAGG + Intronic
1164665283 19:30028029-30028051 AAATGTTACTAGAGAAAAAAGGG - Intergenic
1165189815 19:34053310-34053332 TAGGGTTACCAAAGGAAAGAAGG + Intergenic
1166125221 19:40711176-40711198 AAGAGTCACCAGAAGACAGAGGG - Intronic
1166479894 19:43162499-43162521 AAGTGTAATGAGAGGAAAGTAGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1167530768 19:50014805-50014827 AAGTATGAGCAGAGGAATGATGG + Intronic
1168405307 19:56107570-56107592 AAGGGTCACCAGGAGAAAGAGGG + Intronic
925442640 2:3901530-3901552 AAGTGGTACTAGAGGAAAACAGG - Intergenic
926247915 2:11134100-11134122 AAGTGTGACCAGCGGTAAGAAGG + Intronic
927106049 2:19827026-19827048 GAGTGTTAGCAGAGATAAGAAGG + Intergenic
928665172 2:33543676-33543698 AATTATTATCAGAGGAGAGAAGG + Intronic
929095454 2:38259343-38259365 AGATGTTACAAGAAGAAAGAAGG - Intergenic
929114409 2:38432169-38432191 AAATGTAAACAGTGGAAAGAAGG + Intergenic
929322467 2:40561220-40561242 AAATGTTTTCAGAGGAAAGATGG - Intronic
930436100 2:51344182-51344204 GAGTTTTACCACAGGCAAGATGG + Intergenic
930531479 2:52594172-52594194 AAGTGCTGCCAGAGTAAACAAGG + Intergenic
931216288 2:60248023-60248045 AAGTGTTAGAGGAGGAAGGAAGG + Intergenic
931326209 2:61227186-61227208 AAGTGTTATCAGAGGAAGAAGGG - Exonic
931460552 2:62446891-62446913 AAGTTTCACCAGAGGTGAGAAGG - Intergenic
931824380 2:65984462-65984484 AAGAGATACCAGTGGGAAGAGGG - Intergenic
933171128 2:79127263-79127285 AAGTGTTACTAGAGGAAAGGAGG - Intergenic
933523065 2:83399270-83399292 GAGTACTACCAGAGGAAAAAAGG + Intergenic
936231889 2:110709858-110709880 AATTGTTACAAGAGGCAAGGAGG - Intergenic
936689068 2:114864424-114864446 AAGTGTTATTAAAGGAAATAGGG + Intronic
937941367 2:127288635-127288657 AAGTGGTACCAGAGTTAAGAAGG - Intronic
938317598 2:130340847-130340869 AAGTGTTCCCTGTGGATAGAGGG + Intronic
939042503 2:137207965-137207987 AAGTGTTCCCAGACCAAACAGGG + Intronic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
939439489 2:142226184-142226206 AAGAGTTACCAGAAGACAGTGGG + Intergenic
940294525 2:152108707-152108729 AGTTGTTACCATAGCAAAGATGG - Intergenic
940892196 2:159045998-159046020 ACGTGTTACCACAGGAAGAAAGG - Intronic
941975186 2:171396396-171396418 GACTGTTACCAGAGATAAGAAGG - Intronic
942973273 2:181982840-181982862 AAGTGATACTGGAGTAAAGATGG - Intronic
943369134 2:186994820-186994842 AAGTTTTACCCAAAGAAAGAAGG + Intergenic
943862906 2:192891699-192891721 TAATGTTATCAGAGAAAAGATGG + Intergenic
944617796 2:201480647-201480669 AAGTATTAACAGAAGAAAAAGGG - Exonic
945382223 2:209154529-209154551 AAGTCTTTCTAGATGAAAGAAGG - Intergenic
946441204 2:219698047-219698069 AAGTCATGCCAGAGAAAAGATGG + Intergenic
947476602 2:230454665-230454687 AAGTTTTAACAAAGTAAAGAAGG - Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948079710 2:235195744-235195766 AAGATTCACCTGAGGAAAGAGGG - Intergenic
948914002 2:241021057-241021079 AGGTGTTCCCATAGGGAAGAAGG - Intronic
1169413315 20:5393317-5393339 AATTGTTAACTGAGGAAAGCAGG + Intergenic
1170746253 20:19101511-19101533 AAGTACTACCAGAGAACAGATGG - Intergenic
1172361886 20:34318460-34318482 ACGTGATAACAAAGGAAAGATGG + Intergenic
1173015850 20:39225076-39225098 AAAGTTTACCAAAGGAAAGAAGG - Intergenic
1173618247 20:44416789-44416811 AATTGTTGTTAGAGGAAAGAAGG - Intronic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1176767100 21:13030858-13030880 AAGTGTTATCAGAGGAGATTTGG + Intergenic
1177869413 21:26552983-26553005 AAATGATACCAGAGAAAACATGG - Intronic
1178073875 21:28997758-28997780 AAGTCATACCGGAGAAAAGATGG - Intergenic
1178463112 21:32821032-32821054 AAGTGTTATCAGAAAGAAGAGGG - Intergenic
1180017866 21:45099046-45099068 TAGTGTTACCAGCAGACAGATGG + Intronic
1180431661 22:15257223-15257245 AAGTGTTATCAGAGGAGATTTGG + Intergenic
1180514222 22:16125129-16125151 AAGTGTTATCAGAGGAGATTTGG + Intergenic
1182045456 22:27270711-27270733 AAGGGTAACCAGAGAAAGGAGGG + Intergenic
1182069608 22:27454410-27454432 AGCTGTTACGAGAAGAAAGATGG - Intergenic
1184016102 22:41786776-41786798 AACTGCTACCAGAAGAAGGAGGG + Intronic
1185096389 22:48808363-48808385 AAGAATTCCCAGAGGAGAGAGGG - Intronic
949330211 3:2913987-2914009 AATTGATAGCAGAGGAAAAACGG + Intronic
950168748 3:10821467-10821489 AAGTGTAACCAGAGGAAAATGGG + Intronic
951081768 3:18458585-18458607 AATTATTTCCAGAGGAAAGGGGG - Intergenic
953998174 3:47536470-47536492 ACGTGTCACCAGCGGAAAGCCGG + Intergenic
955309437 3:57870229-57870251 AAGTGTTACCATAGCTAAAATGG + Intronic
956490387 3:69765128-69765150 AAATGCCACCAGAGGAAAGTGGG - Intronic
958578392 3:95983957-95983979 TAGTGTTACCCTATGAAAGATGG - Intergenic
958669884 3:97190207-97190229 AAGTGGTAACAGTGAAAAGATGG - Intronic
959507706 3:107174449-107174471 AATGGTTACCAGATAAAAGAAGG + Intergenic
959770380 3:110088235-110088257 AATTGTAACCAGAAGAAAGCAGG - Intergenic
961727163 3:128939053-128939075 AATTGTTTTCATAGGAAAGAAGG - Intronic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
962751947 3:138440106-138440128 ATGTGTCACCAGAGAAAAGCAGG - Intronic
963779240 3:149470488-149470510 AAGTATAACAAGAGCAAAGATGG - Intergenic
966748743 3:183302484-183302506 AAGACTAACTAGAGGAAAGAGGG + Intronic
967974882 3:195028272-195028294 AATTGTTACCAGTGGAAGGTTGG - Intergenic
971612540 4:28744172-28744194 TTATGTTAACAGAGGAAAGAAGG - Intergenic
973169246 4:47118978-47119000 AAGTGTTACTAGAAAAATGAAGG - Intronic
973244959 4:48001535-48001557 AAGTATTACCAGAATAAACAGGG + Intronic
973345263 4:49047985-49048007 AAGTGTTACGGTAGGAGAGAAGG + Intronic
975901145 4:79154721-79154743 AAGTGCTAGGAGAGGACAGAGGG - Intergenic
976209520 4:82653428-82653450 AAGTGTTTCCAGAGAAAAAGAGG - Intronic
978549755 4:109912813-109912835 AAGTGTCACTAAAGGAAAGGAGG + Intergenic
979248179 4:118533640-118533662 AAGTTTTGTAAGAGGAAAGAGGG - Intergenic
980135254 4:128852561-128852583 AAGTGTTACAGTAGGACAGAGGG - Intronic
980499631 4:133631733-133631755 AAGAGTTACAAGAAGAATGAGGG - Intergenic
982509217 4:156260161-156260183 AAGTTATACAAGAGGAAGGAAGG + Intergenic
982603434 4:157482738-157482760 AATTGTTACAGGAGGAAAGATGG - Intergenic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
983924416 4:173383483-173383505 ACATGTTACAAGAGCAAAGATGG - Intergenic
984100696 4:175481985-175482007 ATGTGAAAACAGAGGAAAGATGG - Intergenic
985299217 4:188469838-188469860 AAGTGCTACCAGAGAGAAGTAGG + Intergenic
986236773 5:5918043-5918065 AAATGTTACCATTTGAAAGAAGG + Intergenic
986957229 5:13167608-13167630 GTATGTTACCAGAGGAAAGTTGG + Intergenic
987097491 5:14562826-14562848 GTTTGTTACCAGAAGAAAGAGGG - Intergenic
987401885 5:17486451-17486473 AACAGATACCAAAGGAAAGAAGG + Intergenic
987403131 5:17498449-17498471 AACAGATACCAAAGGAAAGAAGG + Intergenic
988359407 5:30215465-30215487 AAGCTTTTCCAGTGGAAAGATGG - Intergenic
989168771 5:38455187-38455209 AAGTGCCACCACAGGAAAGCAGG + Intronic
990062416 5:51668449-51668471 AAGTGTTAGTACAGGAAATAGGG - Intergenic
992117330 5:73552247-73552269 AAGTGTTACGGCAGGACAGAAGG + Intergenic
993726493 5:91373798-91373820 AAGTGGTAACAGAGGAACAAAGG - Exonic
994654498 5:102573602-102573624 AATGGTTACCAGAGGCCAGAAGG + Intergenic
996075221 5:119185102-119185124 AGGTGAAAGCAGAGGAAAGAAGG - Intronic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997766099 5:136505176-136505198 AACTTTTAAGAGAGGAAAGAAGG + Intergenic
998329755 5:141314442-141314464 TAGGGTTACCAGAGAAAATAAGG + Intergenic
998330830 5:141325298-141325320 AAGTGTTACAAGAGGAAAAAGGG + Intergenic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1000302782 5:159971206-159971228 AAGTGTTCCCAGTAGAAACATGG - Intronic
1000369928 5:160525388-160525410 TAGTGTCACCAGAGAATAGAGGG + Intergenic
1000454320 5:161430408-161430430 AAGTGATACCAGAGAAAAGTGGG - Intronic
1001722626 5:173869018-173869040 AAGTTTTACCTGAGGAACTAAGG - Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002486429 5:179540810-179540832 AAGAGTTACGAGAATAAAGATGG - Intergenic
1002826903 6:782203-782225 AGGTGTTTGCAGAGGAGAGAAGG + Intergenic
1003187243 6:3842559-3842581 AATTTTTACCAGGGAAAAGAGGG - Intergenic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1003416313 6:5911651-5911673 AAGTGATCCCAGAGGAAACTTGG - Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1005855910 6:29863314-29863336 AGGTGATACAATAGGAAAGAAGG + Intergenic
1010456290 6:76059542-76059564 TAGTGTTAGCAGAGGAAAGTTGG + Intronic
1010490824 6:76475000-76475022 AATTGTCAACAGAGGAAAGGAGG - Intergenic
1011268904 6:85555555-85555577 AGGGATTCCCAGAGGAAAGAAGG + Intronic
1011440783 6:87384803-87384825 AAGTCCTATCAGAGGAATGAAGG + Intronic
1012167305 6:95973387-95973409 ATGAGTTGCCAGAGGGAAGAAGG + Intergenic
1012408878 6:98933239-98933261 AGAAGTTACCAGAGGCAAGAGGG - Intronic
1012591251 6:100984263-100984285 GAGTTTTACCAGAGAACAGATGG - Intergenic
1012722490 6:102763585-102763607 AATTCTTACCAGAGGTAACATGG - Intergenic
1013273850 6:108565209-108565231 AAGTGATAAAAGAGGTAAGAAGG + Intronic
1015446443 6:133311254-133311276 AAGAGATGCCACAGGAAAGAGGG - Intronic
1015459116 6:133468233-133468255 ACGTGTTTGAAGAGGAAAGAAGG - Intronic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1019755244 7:2763944-2763966 TAGTGTTGCTATAGGAAAGAAGG - Intronic
1020771366 7:12399315-12399337 ACGTCTTACCAGAGACAAGAGGG + Intronic
1021455703 7:20827581-20827603 AAGTCATACCAGAGAAAAGATGG + Intergenic
1022515101 7:30970254-30970276 AAGTGGTTCCAGAGGAAACAAGG + Intronic
1023246280 7:38207762-38207784 AAGTGTTTCCAGAGACAACAGGG + Intronic
1023335539 7:39165234-39165256 AAGGGTTAACAGATGAAGGAGGG - Intronic
1024052460 7:45636072-45636094 AAATATTACCAGAATAAAGAAGG - Intronic
1024848994 7:53687239-53687261 AAGTATTAGCAGAGAAAAAAAGG + Intergenic
1027297275 7:76790290-76790312 AAGTTTTCCCAGAGTAAACAAGG - Intergenic
1027786709 7:82589347-82589369 AAGTGTTACTAGAGAAAATTAGG - Intergenic
1028331444 7:89599539-89599561 AAATGTTGCCAGATGAAAAATGG - Intergenic
1028484120 7:91339763-91339785 TAGTCTTCCCAAAGGAAAGAAGG - Intergenic
1028781769 7:94745417-94745439 AAGTGTTGGCAAAAGAAAGAGGG - Intergenic
1030141177 7:106305410-106305432 AAAAGTTGCCAGAGGAAAGAGGG + Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1032369775 7:131336201-131336223 AAGTGTTACTAGAGATAAAAAGG - Intronic
1032450569 7:132026887-132026909 AAGTGTTAGCAATGTAAAGATGG + Intergenic
1032810519 7:135410319-135410341 AAGTGTTACCAGGGAAAAGTAGG + Intronic
1033583213 7:142754984-142755006 AAGGGTTGCCAGAAGAAACAGGG + Intronic
1033586230 7:142776459-142776481 AAGGGTTGCCAGCGGAAATAGGG + Intergenic
1033590621 7:142805336-142805358 CAGTGTTACCTGAGGAAGAATGG - Intergenic
1034211145 7:149364404-149364426 AATTGATACCAGAGGCAAGGTGG - Intergenic
1034362403 7:150512053-150512075 AAGTATTAACAGAAGAAAAAGGG + Intergenic
1034522075 7:151628200-151628222 AAGTGGTACCAGAGTAGAGCAGG + Intronic
1037913486 8:22758239-22758261 AAGGGTCACCGGAGGGAAGATGG - Intronic
1038137355 8:24802157-24802179 AAGTTTACCCAAAGGAAAGAAGG - Intergenic
1039016005 8:33149505-33149527 AAGTGTAACCAGATTGAAGATGG - Intergenic
1039608161 8:38899993-38900015 CGGTGTTAACAGAGGAAAGGCGG - Intergenic
1040484566 8:47857728-47857750 AAGTGAGCCCCGAGGAAAGAAGG + Intronic
1040947949 8:52904438-52904460 AAGTGTCACTCTAGGAAAGAAGG - Intergenic
1041740324 8:61150731-61150753 AAGTGAAACCACAGAAAAGAGGG - Intronic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042094563 8:65199406-65199428 AGGTGCTACCAGAGATAAGAGGG - Intergenic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1042652965 8:71063198-71063220 AATAGTTTCCAGAGGCAAGATGG + Intergenic
1044705344 8:95003184-95003206 AACTGGTACCAAAGGAAGGAGGG + Intronic
1044762761 8:95539226-95539248 AAATGTTAACACAGAAAAGAGGG - Intergenic
1044805204 8:96000833-96000855 AAGTCTTACAATGGGAAAGATGG + Intergenic
1046744571 8:117862988-117863010 AGGTGTTGGCAGAGGAAGGAAGG + Intronic
1047591039 8:126328000-126328022 ATGTGTTTCATGAGGAAAGAAGG + Intergenic
1047845451 8:128800769-128800791 AAGAGTAAAGAGAGGAAAGAAGG - Intergenic
1048080537 8:131121837-131121859 AAGTTTCCCCAGAGGAAAGTGGG - Intergenic
1048647367 8:136437344-136437366 AAGTGTTATCAGAGGAGATTTGG - Intergenic
1049691001 8:143958848-143958870 AGGTGTCACCACAGGAAACATGG + Intronic
1050306210 9:4308325-4308347 AGGGGTTACCAGAGGAGAGGAGG + Intronic
1050416539 9:5423603-5423625 GAGTGTTTCAAGAAGAAAGAAGG - Intronic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1052227998 9:26112281-26112303 AAGTGTTACCAGTGCCAAGAAGG + Intronic
1052269303 9:26610069-26610091 AAGGGAGCCCAGAGGAAAGAAGG + Intergenic
1053708017 9:40775322-40775344 AAGTGTTATCAGAGGAGATTTGG - Intergenic
1054417928 9:64896112-64896134 AAGTGTTATCAGAGGAGATTTGG - Intergenic
1056232633 9:84562487-84562509 AAGTGTGGCATGAGGAAAGAAGG + Intergenic
1057246636 9:93460977-93460999 AGGTGTAACAAGAGGAAAGGTGG - Intronic
1057347474 9:94263338-94263360 AAGTGTTACCAGAGATACAAAGG - Intronic
1058506581 9:105672559-105672581 TAGTGTTACCAGAGAAAAGCAGG - Intergenic
1060116675 9:120946946-120946968 AGGTGTGACGGGAGGAAAGAAGG - Intergenic
1060762349 9:126266608-126266630 AATGGTTAGCAGTGGAAAGAGGG - Intergenic
1061111215 9:128572680-128572702 AAGTGGTAGCAGAGGAAGGTGGG + Intronic
1061912958 9:133734667-133734689 AAGTGAGACCTGAGGAAAGTGGG + Intronic
1186264282 X:7814831-7814853 AAGGCTTGCCTGAGGAAAGATGG - Intergenic
1187260822 X:17683761-17683783 AAGGGTTACAACAGGAAATAAGG - Intronic
1187996040 X:24927500-24927522 GAGTGTTACCAGAGTAATAAGGG - Intronic
1188468020 X:30504928-30504950 AAGGGTCAGCAGAGGAAACATGG - Intergenic
1189595494 X:42560712-42560734 AAATGTTACCAGAGTATGGAAGG - Intergenic
1190568314 X:51754251-51754273 AAATGTACCCAGGGGAAAGAAGG - Intergenic
1190623072 X:52308062-52308084 AAGTGTTACAAGAAAACAGATGG - Intergenic
1190949954 X:55133733-55133755 AAGTGTTTCTGGAAGAAAGAGGG + Intronic
1191184735 X:57597305-57597327 AAATATTTCCAGAGCAAAGAGGG - Exonic
1191607641 X:63079655-63079677 AAGAGATACCATAGGAAAGAAGG - Intergenic
1194050265 X:89059467-89059489 AAGTGTGATCAGAGGACAAAAGG + Intergenic
1194662661 X:96643927-96643949 AACTGCTACCAGAGAAAATAAGG - Intergenic
1195255686 X:103087588-103087610 TACTTTTACCAGAGGAAAGATGG + Intronic
1196373549 X:115004900-115004922 AAGAGTTACAAGAGAAAAGCAGG - Intronic
1197878330 X:131135583-131135605 AAGTGTCACCAGAGATAAGGAGG + Intergenic
1199555289 X:149101553-149101575 TAGTGTTACCAGATAAAATATGG + Intergenic
1201707237 Y:16950429-16950451 AAGTGATACCAGAGCAAACATGG + Intergenic