ID: 911112091

View in Genome Browser
Species Human (GRCh38)
Location 1:94199800-94199822
Sequence CAATCCACACAGGGCCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911112091_911112100 28 Left 911112091 1:94199800-94199822 CCCTTGTGGCCCTGTGTGGATTG No data
Right 911112100 1:94199851-94199873 ATCCTAAGTTTTTCTTTCAATGG 0: 1
1: 0
2: 1
3: 37
4: 396
911112091_911112096 -3 Left 911112091 1:94199800-94199822 CCCTTGTGGCCCTGTGTGGATTG No data
Right 911112096 1:94199820-94199842 TTGACATGTCCCCTTCTCTTGGG 0: 1
1: 0
2: 3
3: 31
4: 212
911112091_911112095 -4 Left 911112091 1:94199800-94199822 CCCTTGTGGCCCTGTGTGGATTG No data
Right 911112095 1:94199819-94199841 ATTGACATGTCCCCTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911112091 Original CRISPR CAATCCACACAGGGCCACAA GGG (reversed) Intronic