ID: 911113198

View in Genome Browser
Species Human (GRCh38)
Location 1:94213614-94213636
Sequence AACAGGCAGCTGGCCAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1374
Summary {0: 3, 1: 23, 2: 142, 3: 348, 4: 858}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911113194_911113198 -1 Left 911113194 1:94213592-94213614 CCAATAAACCTTTATTTACAAAA 0: 11
1: 774
2: 1329
3: 1418
4: 1850
Right 911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG 0: 3
1: 23
2: 142
3: 348
4: 858
911113196_911113198 -9 Left 911113196 1:94213600-94213622 CCTTTATTTACAAAAACAGGCAG No data
Right 911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG 0: 3
1: 23
2: 142
3: 348
4: 858

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911113198 Original CRISPR AACAGGCAGCTGGCCAGATT TGG Intronic
900568677 1:3347765-3347787 AGCAGGCATCAGGCCAGATCTGG - Intronic
901121594 1:6898849-6898871 AACAGGTAGCTGGCCAACATGGG + Intronic
901176963 1:7310485-7310507 AACAGGCAGTGAGCCAAATTTGG + Intronic
901453613 1:9351107-9351129 AATAGACAGTGGGCCAGATTTGG - Intronic
901475215 1:9484887-9484909 AACAGGCAGCAGGAGGGATTTGG + Intergenic
901561487 1:10075237-10075259 AACAGGCAGTAGCCCAGATTTGG + Intronic
901777108 1:11567626-11567648 AACAGGCAGTGGGCCGGATTTGG - Intergenic
901803497 1:11723203-11723225 ACCAGGCAGTGGGGCAGATTTGG + Exonic
901804186 1:11727304-11727326 AAAGGGTAGCGGGCCAGATTTGG + Intergenic
901935496 1:12623502-12623524 AAAAGGCAGTGGTCCAGATTTGG + Intergenic
902053929 1:13584588-13584610 AACAGGCAGGGCGCCAGACTAGG - Intronic
902190687 1:14760995-14761017 GACAGGCAGCGGGCCAGATTTGG + Intronic
902559134 1:17266147-17266169 AACAGGCAGTAGGCCAGATTTGG + Intronic
902641770 1:17771356-17771378 AACAGGCAGTGAGCCGGATTTGG + Intronic
902750074 1:18502058-18502080 AGCAGGCAGAGGGCCAGATTTGG + Intergenic
902780891 1:18704213-18704235 AACAGGGAGCTGGACAGATGTGG - Intronic
903061007 1:20668728-20668750 AATAGCCTGCAGGCCAGATTTGG - Intronic
903455087 1:23482044-23482066 AAGAAGCAGCCGGTCAGATTTGG - Intronic
903526813 1:23996913-23996935 AACAGGCTGCAAGCCAGATTTGG - Intergenic
903584196 1:24396616-24396638 AATAGGCAGTGGGTCAGATTTGG + Intronic
903727643 1:25462888-25462910 AACAGGCAGTGGGCCAGATTTGG - Intronic
903781343 1:25821806-25821828 ATTAGGCAGGTGGCCAGATGAGG - Intronic
904064667 1:27739990-27740012 AACAGCAACCTGGCCAGTTTAGG + Intronic
904156750 1:28490153-28490175 TACAGGCAACTGGCGAGATGTGG + Intronic
904944553 1:34189750-34189772 GACAGGCAGCTGTCCAGCATGGG - Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905089232 1:35414637-35414659 AACAGGGAGCAGGCCAGATTTGG - Intronic
905467052 1:38163008-38163030 AACAGGCAGTGGGCTGGATTTGG - Intergenic
905497211 1:38401695-38401717 AAGAGGCAGCAGGTCAGATTTGG - Intergenic
905664424 1:39754111-39754133 AACAGGCAGTGGGCTGGATTAGG - Intronic
905782498 1:40724431-40724453 AACAGGCTGTAGGCCAGATGTGG + Intronic
905930867 1:41786501-41786523 AACAGGCAGCATCTCAGATTTGG - Intronic
906058929 1:42936002-42936024 AACAGGCTGCTGGCTGGATGTGG + Intronic
906137433 1:43509240-43509262 AACAGGTGGCAGGCTAGATTTGG - Intergenic
906256412 1:44354476-44354498 AACAGAAAGCTAGCCAGGTTAGG + Intronic
906816449 1:48885118-48885140 AACAGGAAACAGACCAGATTTGG - Intronic
907398899 1:54212312-54212334 AATAGGTAGCAGGCCAGATTTGG + Intronic
907433397 1:54428260-54428282 AAACGGCAGGTGGCCAGATGTGG + Intergenic
907967899 1:59350976-59350998 AACAGGCAGTAGGCCAGATTTGG - Intronic
908018546 1:59874678-59874700 GACAGGCGGTAGGCCAGATTTGG + Exonic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
908587470 1:65586675-65586697 AACAGGCAGATGGCTGGATTTGG + Intronic
908615852 1:65921705-65921727 AACAAGCAGCAGGCTGGATTTGG + Intronic
908741640 1:67334841-67334863 AACAGGCAGAGGGCCAGATTTGG + Intronic
908941632 1:69441978-69442000 AACAGGCAGAGGGCTAGATTTGG - Intergenic
909407323 1:75305969-75305991 AACAGACAGCAAACCAGATTTGG - Intronic
909986526 1:82167428-82167450 AACAGGTAGTGGGCCAAATTTGG - Intergenic
911107592 1:94147807-94147829 AACAGGTGGCAGGCCTGATTTGG + Intergenic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
911139625 1:94485083-94485105 AACAAGTAGCAGGCTAGATTTGG + Intronic
911226794 1:95315813-95315835 AACAGGCAGCAGGCTGGATTTGG + Intergenic
911903773 1:103539098-103539120 AACAGGCAGCTAGCTGGATTTGG + Intronic
912199994 1:107445965-107445987 AACAGGAAGCAGGCTGGATTTGG + Intronic
912672457 1:111643274-111643296 AACAGACAGTGGCCCAGATTTGG + Intronic
912756766 1:112330727-112330749 AACAGGCAGTGGACCCGATTTGG - Intergenic
912952033 1:114126869-114126891 TACAGGAAGCTGGCCTGAGTGGG + Intronic
913008922 1:114663621-114663643 AACAGGCAGTGGGCCAAATTTGG - Intronic
913326752 1:117634640-117634662 AACCAGCAGCAGGACAGATTTGG + Intergenic
913485690 1:119331083-119331105 AATAGGCAGCACGCCAGATTTGG + Intergenic
914340662 1:146757143-146757165 AACAAGCAGCAGGACAGATTTGG + Intergenic
914421536 1:147532664-147532686 AACAGGTGGCTGGCTGGATTTGG + Intergenic
914736368 1:150421071-150421093 AATAGGCAGCAGGCCAGATTTGG + Intronic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
914784896 1:150820046-150820068 AACAGGCAGTGGGCCTGATTTGG - Intronic
915354518 1:155248127-155248149 AAAGGGCAGCTGGCCAGGTCGGG - Exonic
915950586 1:160187523-160187545 AACAGGCCGAGGGCCAGAATGGG - Intergenic
916083002 1:161247901-161247923 CACAGGCAGCAGGCCAGATTGGG - Intergenic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916589037 1:166172453-166172475 AACTGGCAACTGGCCAGGCTAGG + Intergenic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
917283969 1:173405424-173405446 AACAGGCAGCAGGCTGGAATTGG + Intergenic
917323276 1:173806126-173806148 AACAAGCAGCAGATCAGATTTGG + Intronic
917430577 1:174963682-174963704 AACTGGCAGTGAGCCAGATTTGG - Intronic
917614414 1:176725276-176725298 AACAGGCAGTGGGTCAGATTTGG + Intronic
917622467 1:176810620-176810642 AACAGGCAGCAGACCAGACTGGG + Intronic
917648423 1:177051343-177051365 AACAGGCAGTGGGCCACATTTGG - Intronic
917697821 1:177545741-177545763 AACAGTTTGCAGGCCAGATTAGG + Intergenic
918198705 1:182246953-182246975 AACAGGCAGTGGGCCAGATTTGG + Intergenic
918375564 1:183905764-183905786 AACAGGCAGTGGGCCACATATGG - Intronic
918675491 1:187279774-187279796 AACAAGTAGCTGGCCACATTTGG + Intergenic
919272777 1:195371334-195371356 AACAGACAACAAGCCAGATTTGG - Intergenic
919481308 1:198092947-198092969 TACAGGCAGCAGACAAGATTTGG + Intergenic
919954629 1:202400919-202400941 AACAGGCAGTGGGCTGGATTTGG - Intronic
920353501 1:205353167-205353189 AACAGGCAGCAGGCCAGGGTTGG - Intronic
920918185 1:210275594-210275616 AACAGGCAGAGGGCTGGATTTGG + Intergenic
920997008 1:211002982-211003004 AACAGGCCACTGGCAAAATTTGG - Intronic
921009106 1:211123461-211123483 GACAGGCAGATGGGCAGATATGG + Intronic
921033889 1:211358022-211358044 AACAAGTAGCAGGCCAGATTTGG + Intronic
921258666 1:213365925-213365947 AACAGGTGGCAGGCCAGATTTGG + Intergenic
921412680 1:214852590-214852612 AACAGGTGGCTGGCCAGACATGG - Intergenic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
922251341 1:223851388-223851410 AACAGGCAGAAGGCCAAATTTGG - Intergenic
922374689 1:224950702-224950724 AACAGGTGGCAGGTCAGATTTGG - Intronic
922424770 1:225482536-225482558 AAGAGGCAGCTGGTCAGAGTTGG - Intergenic
922463585 1:225830847-225830869 AACAGGTAGCAGGCTACATTTGG - Intronic
922566585 1:226605364-226605386 GACAGGCAAGTGGCCAGGTTGGG + Exonic
922621140 1:226989098-226989120 AAAATGCAGTGGGCCAGATTTGG - Intergenic
922635181 1:227161645-227161667 AACAGGCAGCAAACCAGATTTGG - Intronic
923311390 1:232738928-232738950 AATAGTCAGATGGCCAGATGTGG - Intergenic
923367630 1:233278356-233278378 ATCAAGCAGCAGCCCAGATTGGG - Intronic
923546121 1:234924571-234924593 AAACAGCTGCTGGCCAGATTTGG - Intergenic
923562528 1:235052110-235052132 AACAGGCCACTGGCCAGATTTGG + Intergenic
923603570 1:235423855-235423877 TCCAGGCAGCTGGCAGGATTCGG + Intronic
923665786 1:235997356-235997378 AACAAACAGTGGGCCAGATTTGG + Intronic
923694947 1:236239262-236239284 AATAAGCAGCAGGCCAGATTTGG - Intronic
924344246 1:243059287-243059309 AAGTGGCAGCTGGCCAGGTGTGG - Intergenic
924559191 1:245143485-245143507 AACAGACAGGTGGACAGAGTGGG - Intergenic
924662872 1:246038055-246038077 AACAGGCAGCAGGCCAGATATGG + Intronic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1062959328 10:1560795-1560817 AACAGCCAGCTGCCCAGTCTGGG - Intronic
1063442052 10:6080766-6080788 AACAGGAAGTGGGCCAGATTTGG + Intergenic
1063890095 10:10620145-10620167 AACAGGTAGTGGGCCAAATTCGG - Intergenic
1064156180 10:12905223-12905245 AACAGGCAGGGGGCCAGATGTGG - Intronic
1064199471 10:13272391-13272413 AACAGGCATCCCGCCAGATGTGG - Intergenic
1064433295 10:15289736-15289758 AGCAGGCAGCAGGCCACATTTGG - Intronic
1064532788 10:16327170-16327192 ACCAGGTAGTGGGCCAGATTTGG - Intergenic
1064669837 10:17701444-17701466 AACAGGCAACAGGCTAAATTTGG - Intronic
1064782449 10:18857282-18857304 AACATGCAGCTGGTCAGAGCAGG - Intergenic
1065137070 10:22682050-22682072 AACAAGCAGCGGGCCAGATCTGG + Intronic
1065270980 10:24033766-24033788 AACAGGTGGCTGGACAGATTTGG - Intronic
1065639304 10:27765736-27765758 AATAGGCAGTGAGCCAGATTGGG - Intergenic
1066252646 10:33649466-33649488 AACAAGCAACTGGCCAGGTGCGG - Intergenic
1067047171 10:42991292-42991314 AAGAGACAGCTGGCCTGACTTGG + Intergenic
1067356606 10:45534264-45534286 AATAGGCAGCAGGCTAGATTTGG + Intronic
1067930101 10:50552079-50552101 AACAGGCAGAAGGCTGGATTTGG + Intronic
1068581675 10:58747834-58747856 CACAGGCAGCTGGCCAGATTTGG - Intronic
1068633436 10:59322062-59322084 AGCAGGCGTCTGGCCAGGTTTGG - Intronic
1068664328 10:59657262-59657284 AACCAGCAGTAGGCCAGATTTGG + Intronic
1068696161 10:59970050-59970072 AATAGACAACTGGCCAGATGCGG + Intergenic
1068834007 10:61532207-61532229 AATAAGCAGCAGGCCAGACTTGG + Intergenic
1068867275 10:61907740-61907762 AACAGACAGTGGGCCAGATTTGG - Intronic
1069061226 10:63896509-63896531 AATAGGCAGTAGGCCACATTTGG - Intergenic
1069079858 10:64077285-64077307 AACAGGCAGCTGGATGGATGAGG + Intergenic
1069296601 10:66853020-66853042 AACAGGTGGCAGGCCAGATTTGG - Intronic
1069337848 10:67374289-67374311 AACAGGTAGCCAGCCAGATTTGG + Intronic
1069571279 10:69495800-69495822 AGCAGGTGGCTGGCCAGATTGGG + Intronic
1069669750 10:70191873-70191895 AACAGGCAGCAGGCTGGATTTGG + Intergenic
1069872532 10:71541963-71541985 GACAGGCAGTGGGCCAGATTTGG + Intronic
1070237175 10:74640765-74640787 AATAGGCAGCTAGCCAGATTTGG + Intronic
1070326689 10:75394397-75394419 ACCAGGCTGCTAGCCACATTCGG + Intergenic
1070413231 10:76164445-76164467 AACAAGCCACTGGCCATATTTGG - Intronic
1070431971 10:76349351-76349373 AACAGGCAGTGGGCCAGATTTGG + Intronic
1070567994 10:77618456-77618478 AACTGGCAACTGGCCAGGTATGG + Intronic
1070918412 10:80169230-80169252 AACAGGCTGCTGGGCAGAGGGGG + Exonic
1070960534 10:80497368-80497390 AACAGGCGGAAGGCCAGGTTTGG - Intronic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1071878631 10:89870106-89870128 AACTGGCTGCTAGCCAGATTTGG - Intergenic
1072329105 10:94328497-94328519 AACAGGTGGCAGGCTAGATTTGG + Exonic
1072463569 10:95642183-95642205 AACCAGCAGCATGCCAGATTTGG - Intronic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1072557534 10:96532738-96532760 AACAGGGAGCAGGCCAGATTTGG + Intronic
1072865733 10:99059147-99059169 AACAGGAAGCAGGCCAGATTTGG + Intronic
1072952138 10:99857181-99857203 AACAGGTAGCAGGGCAAATTTGG - Intergenic
1073071814 10:100799032-100799054 AACTGGCAGCTGGGAAGACTGGG + Intronic
1073318524 10:102599791-102599813 AACAGACAGGAGGCCAGGTTGGG + Intronic
1073400899 10:103256768-103256790 AACAGGCAGTGGGCTGGATTTGG - Intergenic
1073530120 10:104223088-104223110 AACAGGTGGTGGGCCAGATTTGG + Intronic
1073993766 10:109293080-109293102 AACAGGCAGTGGACCAAATTTGG - Intergenic
1074158649 10:110819379-110819401 AACAGGCTGTAGGTCAGATTCGG + Intronic
1074645247 10:115442639-115442661 AACAGGCTGTGGACCAGATTTGG + Intronic
1074876150 10:117614839-117614861 AACAGGCAGCTGGAAAGATTTGG - Intergenic
1074922793 10:118034169-118034191 AACTGGCAGCAAGCCAGATTTGG + Intronic
1075038109 10:119086248-119086270 AACAGGCAGTAGACCAAATTTGG + Intergenic
1075229351 10:120660398-120660420 AACAGACAGCAAGTCAGATTTGG + Intergenic
1075358575 10:121807743-121807765 AACAAGCAGCAGACCAAATTTGG - Intronic
1075952953 10:126497843-126497865 AACAGGCAGCAGGCTGGACTCGG + Intronic
1075953139 10:126499072-126499094 AACAAGCAGTGGGCCAGATTTGG - Intronic
1076058017 10:127391373-127391395 AACAGGCAGCTGCCAAGATAAGG + Intronic
1076110240 10:127854715-127854737 AAGAGGCAGTTGGCTAGATTTGG + Intergenic
1076154860 10:128195938-128195960 AACAGGCAGCAGGCTAGATTTGG - Intergenic
1077340474 11:2024176-2024198 ACCATCCAGCTGGCCAGATGAGG - Intergenic
1077596216 11:3533960-3533982 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1077658698 11:4046941-4046963 AACAGGCATTTGGCCAGACATGG - Intronic
1077765045 11:5149375-5149397 AACAGGAAGTAGGCCAGGTTTGG - Intergenic
1078418877 11:11190426-11190448 AAAATGCTGCTGGCCAGATGTGG - Intergenic
1078977080 11:16490256-16490278 AACAGGTAGTGTGCCAGATTGGG + Intronic
1079023833 11:16930057-16930079 AGCAGGGAGCTGGCCAGTTGTGG + Intronic
1079049222 11:17138806-17138828 AACAGAGAGCAGGCCAGATTTGG + Intronic
1079981159 11:27152798-27152820 AACAAGCAGTGGGGCAGATTTGG + Intergenic
1080185969 11:29486780-29486802 AACAGAGAGATGGCCACATTTGG - Intergenic
1080296890 11:30740299-30740321 AACAGGTGGCTTGCCAGGTTTGG + Intergenic
1080313567 11:30923120-30923142 AACAGGCAGGGGACCAGATTTGG - Intronic
1080424191 11:32141140-32141162 AATAGGCAGTGGGCCAGATTTGG + Intergenic
1080479365 11:32630291-32630313 AACAGGCAGCAGGCTGCATTTGG - Intronic
1080868877 11:36219046-36219068 AACAGGTAGCAGGTCAGATTTGG - Intronic
1081028640 11:38048838-38048860 AACAGGTAGTGAGCCAGATTTGG - Intergenic
1081347018 11:42000654-42000676 AACAGGCAGTGGGCCAGACTTGG - Intergenic
1081547327 11:44080806-44080828 AACAGGCAGCAGGCTATGTTTGG + Intronic
1081615822 11:44590667-44590689 AACAGGCAGGGGGCTGGATTTGG + Intronic
1081828409 11:46081756-46081778 AACAGGTGGTGGGCCAGATTTGG - Intronic
1082196671 11:49315086-49315108 AAAAGGCATCTGGCTACATTTGG - Intergenic
1083865585 11:65451460-65451482 ACGGGGCAGCTGGCCAGGTTGGG - Intergenic
1084065716 11:66702984-66703006 AACAGGCAGCAGGCTGGATTTGG + Intronic
1084252124 11:67907940-67907962 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1084303620 11:68267146-68267168 AACAGGCAGCAGGTGGGATTCGG + Intronic
1084602333 11:70153351-70153373 AACAGACAGGGGGCCAGATTTGG + Intronic
1084682526 11:70674844-70674866 AACAGGCAATGGGCCAGATTTGG + Intronic
1084782684 11:71420945-71420967 AGCAGTCGGTTGGCCAGATTTGG - Intergenic
1084820723 11:71688094-71688116 AACAGTCAGAGGGCCAGAATTGG + Intergenic
1085273015 11:75281438-75281460 AACAGGCACCTGAGCAGACTGGG + Intronic
1085607437 11:77914747-77914769 AGCAGGCAACAGGCCAGCTTTGG + Intronic
1085797050 11:79551504-79551526 AACAGGTGGCAAGCCAGATTTGG + Intergenic
1086384302 11:86291340-86291362 AACAGACAGCTGGCCAGGTTCGG - Intergenic
1086460056 11:86997128-86997150 AACAGGCAGTGGTCCAGACTTGG - Intergenic
1086486774 11:87312764-87312786 AACAAGTAGCAGGCCAGATTTGG + Intronic
1086659155 11:89393119-89393141 AAAAGGCATCTGGCTACATTTGG + Intronic
1086888514 11:92228768-92228790 ACCAGGCAACTGGACAGATGTGG - Intergenic
1087283198 11:96235243-96235265 AACAGCCTGCAGGCCAGATTTGG - Intronic
1087357291 11:97110719-97110741 AACAGGCATCTGACTGGATTTGG - Intergenic
1087879319 11:103396297-103396319 AACTAGCAGCAGGCTAGATTTGG - Intronic
1087912531 11:103770309-103770331 AACAGGTGGCAAGCCAGATTTGG - Intergenic
1087949183 11:104199201-104199223 AACAGGCACTGGGCCAAATTTGG + Intergenic
1088069603 11:105765664-105765686 AAAAGGCTGTTGGGCAGATTTGG - Intronic
1088468632 11:110169955-110169977 AACGGGAAGCCGGTCAGATTGGG + Exonic
1088536042 11:110862536-110862558 AACTGGCCACTGGGCAGATTTGG + Intergenic
1088726544 11:112642173-112642195 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1088758332 11:112906005-112906027 AACAGGTGGCAGGCCAGATTTGG + Intergenic
1089281360 11:117377000-117377022 AAGAGGCTGCTGGCCACATCAGG - Intronic
1089425898 11:118374478-118374500 AACAGGTGGCAGGCCAGATTTGG - Intronic
1089474692 11:118749448-118749470 TAGAGGCAGCTGTCCAGTTTTGG - Exonic
1089904569 11:122025225-122025247 AACAGGCGGTTGGCCAGATCTGG + Intergenic
1089919978 11:122199899-122199921 AACAGGTAGTGGACCAGATTTGG + Intergenic
1089951412 11:122531230-122531252 AACAGGTGGCAGGCTAGATTTGG + Intergenic
1090373614 11:126273920-126273942 AACAGGCAGCAGGTCGGATTTGG + Intronic
1090523834 11:127507363-127507385 AGCAGGTAGCAGGCCAGATGTGG + Intergenic
1202823459 11_KI270721v1_random:79365-79387 ACCATCCAGCTGGCCAGATGAGG - Intergenic
1091733499 12:2899401-2899423 AACTGACGGCAGGCCAGATTTGG + Intronic
1091849780 12:3686379-3686401 AACAGGTAGTGGCCCAGATTTGG + Intronic
1091880635 12:3974654-3974676 AACAGGCAGCAGGCAGGATTAGG - Intergenic
1092224416 12:6738217-6738239 AACAGGCAGTGGGCTGGATTTGG - Intergenic
1092307027 12:7311658-7311680 AAAAGGTGGCAGGCCAGATTTGG - Intronic
1092422390 12:8342732-8342754 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1092846155 12:12587004-12587026 AACAGGCAATTGGCCAGCTTAGG + Intergenic
1093094933 12:14961185-14961207 AGCAGGCACCTGGCCAGGCTTGG - Intronic
1093139421 12:15490566-15490588 AACAGGTGGCAGGGCAGATTTGG + Intronic
1093204693 12:16233522-16233544 AACAGACGGTGGGCCAGATTTGG + Intronic
1093440741 12:19192896-19192918 AACAGGCAGCAGGCTGGATTTGG - Intronic
1094281912 12:28749600-28749622 AACACGCAGCAGGCCATAATAGG + Intergenic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1094554566 12:31485600-31485622 AACAGTCAGCTGGACAGATTTGG + Intronic
1094654778 12:32409650-32409672 AACAGGCAGCTGGGGAGACATGG - Intronic
1095156630 12:38864247-38864269 AACCAGCAGCAGGCCAGATTTGG - Intronic
1095254447 12:40018128-40018150 AACAGAAAGCCGGCCAGATTTGG - Intronic
1095454543 12:42369010-42369032 AACAGACAGCTGACCAGATTTGG - Intronic
1095549900 12:43423303-43423325 AATAGGCAACAGGCCAGATTTGG + Intronic
1096371865 12:51075670-51075692 AACAGGCATTGGGCCAGATTTGG + Intronic
1096744948 12:53720446-53720468 AACAGGTGGCAGGCTAGATTTGG + Intronic
1096980061 12:55723516-55723538 TGTAGGCAGCTGGCCAGATCTGG - Exonic
1097007166 12:55927767-55927789 AAGAGGCAGCGGACCAGGTTGGG + Exonic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1098115026 12:67166024-67166046 AATAGGCCACAGGCCAGATTTGG - Intergenic
1098377346 12:69831216-69831238 AACAGGCTGCAGGCCAGATTTGG - Intronic
1098513747 12:71349636-71349658 AACAGGTGACAGGCCAGATTTGG + Intronic
1098569792 12:71975400-71975422 AACAGGCAGTGGGCTGGATTTGG + Intronic
1098571621 12:71994030-71994052 AACAGGCAATGGACCAGATTTGG + Intronic
1098985049 12:77003071-77003093 AACAGGCTGCAGGCTAGATTTGG + Intergenic
1099126436 12:78764005-78764027 AATAGGCAGTGGGCCAAATTTGG + Intergenic
1099346506 12:81506893-81506915 AACAGGTAGCAGGCCAGATGTGG + Intronic
1099517875 12:83621307-83621329 AACAGGCAGTGGTCCAAATTTGG + Intergenic
1099646827 12:85367985-85368007 AACAGGCAGCAGGTTGGATTTGG + Intergenic
1099818483 12:87678733-87678755 AACAGGCAGTAGGCTAGATTTGG + Intergenic
1099919125 12:88935188-88935210 AACAGGAAGCTAGCAAGATGGGG - Intergenic
1100392706 12:94158015-94158037 AACAGGCAACAAGCCAGATTTGG + Intronic
1100512603 12:95291621-95291643 AACAGGCAGTGGGGCAGATTTGG + Intronic
1100746034 12:97646919-97646941 AGTAGGCTGCAGGCCAGATTTGG + Intergenic
1101014839 12:100489593-100489615 AACAGGCAGCCGACCGGATTTGG + Intronic
1101039560 12:100740682-100740704 AACAGGTAGCCAGCCAGATTTGG - Intronic
1101051551 12:100868944-100868966 AACAGACAGCAGGCCAGATGTGG + Intronic
1101208013 12:102508208-102508230 AACAGGCAATGGGCCAGATTTGG - Intergenic
1101366289 12:104073846-104073868 AAAAGACAGCAGGCCACATTTGG - Intronic
1101427479 12:104599813-104599835 AATGGGCAGTGGGCCAGATTTGG - Intronic
1101439655 12:104694052-104694074 AACAGGCAGCTAACTGGATTTGG + Intronic
1101814541 12:108135797-108135819 AACAGGCAGTGGGCCAGATTTGG - Intronic
1101844394 12:108350853-108350875 AACAGGCAGTGGGCCAAATCTGG - Intergenic
1101920666 12:108930033-108930055 AACAGGCAAGGGACCAGATTTGG - Intronic
1102033104 12:109754620-109754642 AGCAGCCAGCAGGCCAGATTTGG + Intronic
1102066496 12:109980479-109980501 AACAAGTAACTGGCTAGATTTGG + Intronic
1102173060 12:110856724-110856746 AACCAGCAGCCAGCCAGATTTGG - Intronic
1102198425 12:111040871-111040893 AACAGGCAGGGGGCCGGTTTTGG + Intronic
1102590672 12:113954707-113954729 AACAGGCAGTGAGCCAGATTTGG - Intronic
1102600273 12:114024550-114024572 AACAGGTGGCAGGCCAGATCTGG + Intergenic
1102702977 12:114855838-114855860 AACAGTCAATTGGCCAAATTGGG - Intergenic
1102808472 12:115802972-115802994 AACAAGTAGTGGGCCAGATTTGG + Intergenic
1103008685 12:117441039-117441061 AACAGTCAGTTGGCCAGGTGCGG + Intronic
1103036157 12:117658427-117658449 AGCAGGCGGAGGGCCAGATTTGG - Intronic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1103045786 12:117733454-117733476 AACAGGTAGTGGGCCAGATTTGG - Intronic
1103048510 12:117759250-117759272 AACAGGTACCTGGCCCAATTTGG - Intronic
1103098865 12:118154963-118154985 ACCAGGCACCAGGCTAGATTTGG - Intronic
1103115237 12:118323046-118323068 AACAGGCAGCACAACAGATTTGG + Intronic
1103265775 12:119628964-119628986 AACAGGCAGCAGGCTGGATTTGG + Intronic
1103403975 12:120661792-120661814 AATAGGCATCTGGACAGATAAGG - Intronic
1103701994 12:122853090-122853112 AGCAGGCAGCTGGCCAGCACGGG - Intronic
1103729151 12:123014415-123014437 AAGAGGCAACTGGGCACATTGGG + Intronic
1103810323 12:123608424-123608446 GACAGGCAGCAGCCCAGGTTTGG + Intronic
1103849188 12:123920494-123920516 AACAGGCAGCAGGCTGGATTTGG + Intronic
1103849544 12:123923196-123923218 AGCAGGCAGTGGGCCAGATTTGG - Intronic
1103873887 12:124112282-124112304 AACAGGTGGAGGGCCAGATTTGG - Intronic
1103964137 12:124627351-124627373 ACCAGGCAACAGGCCAGATCTGG - Intergenic
1104122315 12:125811320-125811342 TACAGGCAGCTTGACAGCTTTGG - Intergenic
1104418349 12:128614387-128614409 AATAGGCAGCTGGCTGCATTTGG + Intronic
1104578617 12:129991666-129991688 AACAGGCAACAGATCAGATTTGG + Intergenic
1104666647 12:130652212-130652234 AACAGGTGGTGGGCCAGATTTGG - Intronic
1105348167 13:19592492-19592514 AACAGGTGGCAGGCCAGGTTTGG - Intergenic
1105661616 13:22502119-22502141 TACAGGCATCAGGCCAGATTTGG + Intergenic
1106502275 13:30340413-30340435 AACAGGCAGCAGGCCAGTCCTGG + Intergenic
1107038535 13:35924828-35924850 AACAGGCAATGGGCCAGGTTTGG - Intronic
1107480562 13:40782348-40782370 AACAGGTGGCAGGCCAGATTTGG - Intergenic
1107780116 13:43891104-43891126 AACAGGTAAGGGGCCAGATTTGG + Intronic
1108044441 13:46370057-46370079 AACAGGAAGCTGGCAGGATTTGG + Intronic
1108266252 13:48711886-48711908 AGCAGGCAGCCGGGCAGCTTTGG + Intergenic
1108293199 13:48983557-48983579 ACTAGGCAGCAGACCAGATTTGG + Intronic
1108339652 13:49485888-49485910 AACAGGTAGAGGGCCAGATTTGG - Intronic
1108524265 13:51272525-51272547 AATAGGTGGCAGGCCAGATTTGG - Intronic
1108743864 13:53369366-53369388 AACATGCAGAAGGCTAGATTTGG - Intergenic
1108912159 13:55568411-55568433 AACAGGCTGCAAACCAGATTTGG + Intergenic
1109286427 13:60414290-60414312 AACTGGTAGCAGGCCAGATTTGG - Intronic
1109807461 13:67462299-67462321 AACAGGTGGTGGGCCAGATTTGG + Intergenic
1110162546 13:72396448-72396470 AACAGGCCACGGGTCAGATTTGG + Intergenic
1110403420 13:75120956-75120978 AACAGGCAGGGGGCCAGATTTGG + Intergenic
1110444680 13:75565667-75565689 AAGAGGCAGTGGGCCAGATTTGG + Intronic
1110605747 13:77430117-77430139 AATAGGCATCCGACCAGATTTGG - Intergenic
1110967763 13:81722676-81722698 AACAGGCAGCAGGCTGGACTTGG - Intergenic
1111436662 13:88219776-88219798 AACAGGCACCAGCCCAAATTGGG + Intergenic
1111818935 13:93190576-93190598 AAGAGGAAGCAAGCCAGATTTGG - Intergenic
1111867478 13:93787423-93787445 AACGGGCAATGGGCCAGATTTGG + Intronic
1111893861 13:94116841-94116863 AACAAGCTGCTGCCCAGGTTAGG + Intronic
1112518441 13:100076350-100076372 AACAGAGGACTGGCCAGATTTGG - Intergenic
1112599844 13:100844130-100844152 AACAGGCAGTGGGCTGGATTTGG + Intergenic
1112759643 13:102679908-102679930 AACAGGCAGCAGTCCAGTTTGGG - Intronic
1112836450 13:103520248-103520270 AACAGGCAGATAGACATATTTGG - Intergenic
1113303405 13:109048567-109048589 AACAGGCAGTGGGCCATGTTTGG + Intronic
1113612276 13:111655617-111655639 AACAGGCAGTGGGCCAGAGTTGG + Intronic
1114163382 14:20193533-20193555 AATAGGCAGCAGGCCAGGTTTGG - Intergenic
1114817219 14:25974438-25974460 AACAGATTGCAGGCCAGATTTGG + Intergenic
1115010789 14:28542217-28542239 AAGAGGCAGCTGGATAGAATTGG - Intergenic
1115229512 14:31144670-31144692 AATGGGGAGCAGGCCAGATTTGG + Intronic
1115322493 14:32098733-32098755 AAAAGGCAGCAGGCTGGATTTGG + Intronic
1115442278 14:33449320-33449342 AACAGGCAGAGGGCTGGATTTGG - Intronic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1116277360 14:42852760-42852782 AACTGGCAGCAGTCCAGATTTGG + Intergenic
1116338108 14:43685601-43685623 AACAGGTGGTAGGCCAGATTTGG - Intergenic
1116707910 14:48326839-48326861 GACAGGCAGCTGGCCATACCTGG + Intergenic
1116883358 14:50194141-50194163 AACAGGCTGCAGGCTGGATTTGG - Intronic
1116995471 14:51319293-51319315 AACAGTCAGCAAGCCAGATTAGG - Intergenic
1117485832 14:56195804-56195826 AACTGCCAGCTGGGCAGATTAGG - Intronic
1117673422 14:58131356-58131378 AACAAGTGGCAGGCCAGATTTGG + Intronic
1117795776 14:59392800-59392822 AGCAAGCAGTGGGCCAGATTTGG + Intergenic
1117962981 14:61180710-61180732 AGCAGGCAGATGGCCAGAGAGGG - Intergenic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1118423048 14:65628833-65628855 AACAGGCAATGAGCCAGATTTGG - Intronic
1119112913 14:71991956-71991978 AACAGGCAGTGAGCCAGATTTGG + Intronic
1119187972 14:72657707-72657729 AATAAGCAGTTGGCCAGATTTGG - Intronic
1119362862 14:74066247-74066269 AACAGGCAGGAAGCCACATTTGG - Intronic
1119496929 14:75087829-75087851 AACAGGCAGTGGGCCAGAATTGG - Intronic
1119824212 14:77643533-77643555 AACAGGCAGCAAGCAGGATTTGG - Intergenic
1120093599 14:80362897-80362919 AACAGACAGTGGGCCATATTTGG - Intronic
1120286792 14:82512909-82512931 AACAGGCAGATAGCTGGATTTGG - Intergenic
1120312094 14:82842115-82842137 GACAGGCAGCTGGAGAGACTTGG - Intergenic
1120464637 14:84840914-84840936 AACAAGCAGTGAGCCAGATTTGG - Intergenic
1120511305 14:85418702-85418724 AAGAGGCCGCAGGGCAGATTCGG + Intergenic
1120518262 14:85495464-85495486 AACAGGCAGTTGGCAGAATTTGG - Intergenic
1120614496 14:86686395-86686417 AATAAGCAGCAGGCCAGATTTGG - Intergenic
1120705521 14:87741297-87741319 AACAAGCAGCAGGCCAGACTTGG + Intergenic
1120804290 14:88729380-88729402 AATAGGCAGCAGGCCTGGTTTGG - Intronic
1120910422 14:89661548-89661570 AACAGGTGGTGGGCCAGATTTGG + Intergenic
1121075266 14:91062641-91062663 AACAGGCAATGAGCCAGATTTGG + Intronic
1121105509 14:91276909-91276931 AACAGGCGGCTAGCTGGATTTGG - Intronic
1121182627 14:91941061-91941083 AACAGGGAGCATGCCACATTAGG - Intronic
1121315956 14:92961161-92961183 AACAGGCATCTGACCGGAGTGGG - Intronic
1121386112 14:93527230-93527252 AACTGGCAGCAGGCCAGATTTGG - Intronic
1121411353 14:93750534-93750556 AACAGGTGGTGGGCCAGATTTGG - Intronic
1121478668 14:94239585-94239607 AACAGGCGGTGGGCCAGATTTGG - Intronic
1121615897 14:95313458-95313480 AAGAGGCAGCAGGCCAGATTTGG + Intronic
1121720095 14:96103250-96103272 AACAGGCAGTGGGCCAGACTTGG - Intergenic
1121830577 14:97048175-97048197 AGCAGGTAGCAGGTCAGATTTGG - Intergenic
1122621712 14:103061678-103061700 AACAAGCAGCAGGCTAAATTTGG + Intergenic
1123481719 15:20638621-20638643 AACAGGCTGCTGACCAGTTCTGG + Intergenic
1123497613 15:20844325-20844347 AACAGGCAGTGGGCTGGATTTGG - Intronic
1123636294 15:22361744-22361766 AACAGGCTGCTGACCAGTTCTGG - Intergenic
1123908715 15:24945566-24945588 TACAGGCAGCAGGCAGGATTTGG + Intronic
1124425725 15:29560887-29560909 CAAAAGCAGCAGGCCAGATTTGG - Intronic
1125310264 15:38371512-38371534 AACAGGTGGCAGGCAAGATTTGG - Intergenic
1125449713 15:39795695-39795717 AACTGGCCCCTGGCCAGACTTGG - Intergenic
1125621300 15:41065145-41065167 AACAGGTAGCAGGCCAGGCTCGG + Intronic
1125635865 15:41188238-41188260 AACAGTCTGCAGGCCAGATTTGG + Intronic
1125778440 15:42240973-42240995 AAAAAGCTGGTGGCCAGATTTGG - Intronic
1125826357 15:42679801-42679823 AACAGGCAGCAGACCAGATTTGG + Intronic
1125829979 15:42708315-42708337 AACAGGAAGCAGGCCAGATCTGG - Intronic
1125848292 15:42879661-42879683 AACAGTCTGCAGGCCAAATTTGG - Intronic
1125894539 15:43291603-43291625 AACAGGCAGTAGGCCACATTTGG + Intronic
1126196590 15:45938274-45938296 AACAGGCAGCAGATCAGATGTGG - Intergenic
1126458770 15:48893504-48893526 AACTGAAGGCTGGCCAGATTTGG + Intronic
1126614499 15:50563122-50563144 AACAGGCAACAGACCAGATTTGG - Intronic
1126651926 15:50931807-50931829 ACCAGGCATTTGGCCAGATTAGG + Intronic
1126666554 15:51080760-51080782 AACAGGTGGCAGGCCAGATTTGG + Intronic
1126748785 15:51854318-51854340 GACAGGCAGCAGGCCGAATTTGG + Intronic
1126934793 15:53694902-53694924 AACAGGCAGCAGGCCTGATTTGG - Intronic
1127760249 15:62132530-62132552 AACAGGAAGCAGGTCAGATTTGG + Intergenic
1128105337 15:65040262-65040284 ACCAGGCTGCAGGTCAGATTTGG + Intergenic
1128190705 15:65692926-65692948 AACAGGCCTCAGGCTAGATTTGG - Intronic
1128221914 15:65975286-65975308 GACAGGAACCTGGCCAGATGTGG - Intronic
1128343631 15:66840118-66840140 AATAGGTGGCAGGCCAGATTTGG - Intergenic
1128795282 15:70462146-70462168 AATAGGCAGTGGGCCAGATTTGG - Intergenic
1128973519 15:72130481-72130503 AGCAGGCAGTGGGCCAGATTTGG + Intronic
1128994059 15:72283922-72283944 AATAGGCCACAGGCCAGATTTGG + Intronic
1129121113 15:73397322-73397344 AACAGACAGCTCCCCAGAGTTGG - Intergenic
1129557514 15:76528174-76528196 AACAGGCAGTGGGCCAGATTTGG + Intronic
1129698431 15:77753980-77754002 GACAGGCACCTGGCAAGGTTTGG - Intronic
1129840310 15:78739584-78739606 AACAGCCACCTGGCCTGATAAGG + Intergenic
1129930625 15:79407606-79407628 AACAGGTGGTGGGCCAGATTTGG - Intronic
1129979144 15:79850542-79850564 AACAGGTGGAGGGCCAGATTTGG + Intronic
1130146033 15:81274221-81274243 AACAGGCGGTGGGCCAGATTTGG - Intronic
1130393073 15:83476513-83476535 AACAGGCAGTGGGCCATATCTGG - Intronic
1130625203 15:85507285-85507307 AACAGGCAGCAGGCTAGATTTGG - Intronic
1130888547 15:88113673-88113695 AACAGGTGCCAGGCCAGATTTGG - Intronic
1131160302 15:90101283-90101305 AAGGGGCTCCTGGCCAGATTAGG + Intronic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1132294408 15:100725059-100725081 AACAGGCAGGCGGCTGGATTTGG + Intergenic
1202963190 15_KI270727v1_random:145162-145184 AACAGGCAGTGGGCTGGATTTGG - Intergenic
1132895391 16:2226743-2226765 CACAGGGTGCTGGCAAGATTTGG + Intronic
1133142998 16:3761928-3761950 AGCAAGCAGCTGGCCACATTTGG - Intronic
1133375891 16:5286867-5286889 AACAGTCAGAGGGCCAGATTTGG + Intergenic
1133418138 16:5622614-5622636 CACAGGCATCGGGCCGGATTTGG - Intergenic
1133608095 16:7407849-7407871 AATAGTCCGCAGGCCAGATTAGG - Intronic
1134147813 16:11781310-11781332 AAAGGACAGCAGGCCAGATTGGG + Intronic
1134303923 16:13015140-13015162 AACAGGCGGCAGGCCAGATTTGG - Intronic
1134337275 16:13312276-13312298 AACAGACAGTGGGCCAGATGTGG + Intergenic
1134397177 16:13875761-13875783 AACAAGCAGCGGGCCAGATCTGG - Intergenic
1134518524 16:14906340-14906362 AACAGACAGCTGGCCAGAGTTGG - Intronic
1134555406 16:15159877-15159899 AACAGACAGCAGGCCAGAGTTGG + Intergenic
1134632121 16:15764106-15764128 AGCAAGCAGTGGGCCAGATTTGG - Intronic
1134649517 16:15897563-15897585 AACAGGCAGGCGGCCAGATGCGG - Intergenic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1134683072 16:16140036-16140058 AACAGGCAAGGGGTCAGATTTGG + Intronic
1134690092 16:16185272-16185294 AAAAGGCAGCAGGCAGGATTTGG - Intronic
1134694574 16:16214008-16214030 AACAGGCAGTGGGCCAGATTTGG - Intronic
1134706195 16:16304993-16305015 AACAGACAGCTGGCCAGAGTTGG - Intergenic
1134756161 16:16669492-16669514 AACAGGTAGTGGGCCAGATTTGG + Intergenic
1134826567 16:17289244-17289266 AACAGGTGGAGGGCCAGATTTGG + Intronic
1134847751 16:17454973-17454995 AACAGGCAAAGGACCAGATTTGG + Intronic
1134961345 16:18407117-18407139 AACAGACAGCTGGCCAGAGTTGG + Intergenic
1134965645 16:18489720-18489742 AACAGACAGCTGGCCAGAGTTGG + Intronic
1134977261 16:18580629-18580651 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1134989907 16:18689672-18689694 AACAGGTAGTGGGCCAGATTTGG - Intergenic
1135062416 16:19282286-19282308 AATAGGCAAGGGGCCAGATTTGG - Intergenic
1135097682 16:19578071-19578093 AACAGGCAGTGGACCAGACTTGG - Intronic
1135121937 16:19773690-19773712 AACAGGTGGTGGGCCAGATTTGG + Intronic
1135151144 16:20007097-20007119 AACAGACAGTGGGCCAGATTTGG - Intergenic
1135283797 16:21175649-21175671 GACAGGCAGCTTGCTGGATTTGG + Intronic
1135595785 16:23741863-23741885 AACAGGCAGCAGGCAGGGTTTGG - Intergenic
1135633334 16:24053449-24053471 AACAGGCAGGAGGCTGGATTTGG + Intronic
1135647797 16:24178478-24178500 AGCAGGCAGCTGGGTAGACTAGG - Intronic
1135720010 16:24808374-24808396 AGCAGGCAGTGGGCCAAATTTGG - Intronic
1135723550 16:24837053-24837075 AACAAGCAGTGGGCCAGATCCGG + Intergenic
1135760631 16:25135358-25135380 AACAGGCTGTGGGCCAGATTTGG - Intronic
1135817567 16:25649417-25649439 AACAAGCAGTGGGCCAGAATTGG + Intergenic
1135830900 16:25772104-25772126 ACAAGGCAGCAGGCTAGATTTGG + Intronic
1135835032 16:25817507-25817529 AATAGGCAGCAAGCCATATTTGG + Intronic
1135961368 16:26997063-26997085 AGCAGGCAGCAGGTCAGATGAGG + Intergenic
1135966867 16:27042762-27042784 AACAGGCAGTGGGCTGGATTTGG + Intergenic
1136001967 16:27301602-27301624 AACACGCAGTGGGCCAGATTTGG + Intergenic
1136007853 16:27343313-27343335 AACAAGCAGTGGGCCGGATTTGG - Intronic
1136042277 16:27589451-27589473 AATAAGTGGCTGGCCAGATTTGG + Intronic
1137673834 16:50294048-50294070 AAAAGGCAGCGGGCCAGCCTTGG - Intronic
1137845910 16:51687909-51687931 AATAGGCAGCTGGCCGGGTTTGG - Intergenic
1137853372 16:51768412-51768434 AACAGGTAGAGGGCCTGATTTGG + Intergenic
1138201470 16:55091633-55091655 AACAGGCCCGTGGCCAGAGTAGG - Intergenic
1138278610 16:55755399-55755421 AAAAGACAGTAGGCCAGATTTGG - Intergenic
1138289945 16:55838222-55838244 AAAAGACAGTAGGCCAGATTTGG + Intergenic
1139048325 16:63090848-63090870 AACAGGCAGTAGACCAAATTTGG - Intergenic
1139755384 16:69138815-69138837 AACAAGCAGTGGGCCTGATTTGG + Intronic
1139780463 16:69347275-69347297 AACAGGCAATGGGCCAGATTTGG + Intronic
1139867117 16:70071165-70071187 ATCAGGTAGTGGGCCAGATTTGG + Intergenic
1139993623 16:70960263-70960285 AACAAGCAGCAGGACAGATTTGG - Intronic
1140026671 16:71297089-71297111 AACAGGCAGTGGGCTGGATTTGG + Intergenic
1140261495 16:73384166-73384188 AACAGGGTGCAGGCCAGATTTGG - Intergenic
1140761549 16:78113475-78113497 AACAGGCAGTGGGCCAGATTTGG + Intronic
1140799538 16:78472960-78472982 AACAGGCTGCAGATCAGATTTGG - Intronic
1141019407 16:80480794-80480816 AATAGGCAATGGGCCAGATTTGG + Intergenic
1141043719 16:80695110-80695132 AACAAACATCTGGCCAGATTTGG - Intronic
1141063103 16:80893077-80893099 ACCAGGCAGCAGGCTGGATTTGG + Intergenic
1141247661 16:82325073-82325095 AATAGGCAGCAGGACAGATCTGG + Intergenic
1141536607 16:84685565-84685587 AACAGGTAGAGGGCCAGATTTGG + Intergenic
1141576809 16:84969358-84969380 AGCCGGCAGATGACCAGATTTGG + Intergenic
1141885162 16:86886693-86886715 AACAGGCAGCAGGCAAGATTTGG - Intergenic
1142402092 16:89864430-89864452 AACAGGCCGAGGACCAGATTTGG - Intronic
1142457974 17:67754-67776 AAGTAGCAGCTGGCCAGATGTGG - Intergenic
1142747135 17:1965552-1965574 AGCAGGAAGCAGGCCAGAGTGGG + Intronic
1142897012 17:2987144-2987166 CACAGGCAGCAGGCCAGACTTGG + Intronic
1143379274 17:6485827-6485849 AACAGGCAGTGGGGCAGATTTGG - Intronic
1143823039 17:9580146-9580168 AACAGGCAGTGGGCCAGATTTGG - Intronic
1143965984 17:10756794-10756816 AACAGGTGGCTGGCCTGATTTGG - Intergenic
1143971169 17:10797038-10797060 AACAGGAGGTGGGCCAGATTTGG + Intergenic
1144294601 17:13861639-13861661 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1145986116 17:29047748-29047770 AACAAGCAGAAGGCCAGATTTGG + Intronic
1146113531 17:30113389-30113411 ACCAGGCAGCTGGCCAGATTTGG - Intergenic
1146119638 17:30180757-30180779 AACAGGCAACAGGCCAGATTTGG + Intronic
1146133321 17:30296946-30296968 AGAAGGCAGCTACCCAGATTTGG - Intergenic
1146528455 17:33587053-33587075 AACAGGCAACAGGCTGGATTTGG - Intronic
1146631160 17:34470435-34470457 AGCAGGCATCTGGTCAGATTTGG + Intergenic
1146640819 17:34540100-34540122 AACAGGTGGCAGGCCAGATTTGG + Intergenic
1147694601 17:42341878-42341900 AACAAGCAGCAGGCTGGATTTGG + Intronic
1147727481 17:42575280-42575302 AACATGCATCTGGCAGGATTTGG - Intronic
1148033980 17:44644161-44644183 AACAGGTGGTAGGCCAGATTTGG + Intergenic
1148787047 17:50150563-50150585 AACAGGCGGCTGGCCAAGTCGGG + Exonic
1148978798 17:51553114-51553136 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1148983072 17:51596038-51596060 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1149030282 17:52074808-52074830 AACAGGCAATGGGCCATATTTGG - Intronic
1149158333 17:53661156-53661178 AACAAACGGCAGGCCAGATTTGG + Intergenic
1149281547 17:55110749-55110771 AATAGGCGGCAGTCCAGATTTGG + Intronic
1149316256 17:55441619-55441641 AAAAGGCAGCTGGCTGGCTTTGG - Intergenic
1149413132 17:56429565-56429587 GACAGGCAGCAGGCTGGATTTGG + Intronic
1149573409 17:57693875-57693897 AATAGGCAACAGGCCTGATTTGG - Intergenic
1149786900 17:59443331-59443353 AACAGGCAGCAGTCCAAATTTGG + Intergenic
1149818678 17:59752274-59752296 AACAGGTAGCAGGCTGGATTTGG + Intronic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1150056931 17:62025703-62025725 AACAGGCAGTGGGCCAAATATGG + Intronic
1150161913 17:62905757-62905779 AAAAGGTGGCAGGCCAGATTTGG + Intergenic
1150175682 17:63052973-63052995 AATAGGTGGCAGGCCAGATTTGG + Intronic
1150192746 17:63260425-63260447 AACAGGTAGCAGGCCATATTTGG + Intronic
1150452604 17:65281444-65281466 AACAGGCAGTGTGACAGATTTGG + Intergenic
1150667090 17:67150939-67150961 AACAGTCAGTGAGCCAGATTTGG + Intronic
1150997157 17:70331771-70331793 AACCGACAGCAGGTCAGATTTGG - Intergenic
1151142096 17:72003432-72003454 AACAGGCTGCGGGCCTAATTTGG + Intergenic
1151177805 17:72302896-72302918 ATCAAGCTGCGGGCCAGATTTGG - Intergenic
1151188967 17:72383779-72383801 AACAGACAGCTGTTCAGATTTGG + Intergenic
1151669968 17:75566625-75566647 AATAGGCAGGAGGCCAGATTTGG + Intronic
1151710174 17:75800023-75800045 AGCAGGCAGCAGGCTGGATTTGG - Intronic
1152150477 17:78597077-78597099 AACAGGCAGAGGGCTAGATTTGG + Intergenic
1152240116 17:79156588-79156610 GAGAAGCAGCGGGCCAGATTTGG - Intronic
1152507561 17:80760624-80760646 AACAGGCAGTTGGCCAGATTTGG + Intronic
1153033590 18:737664-737686 AACAGGCTGCAGGCCACTTTTGG - Intronic
1153141305 18:1975461-1975483 AAGAGGCAACAGGCCATATTTGG + Intergenic
1153443461 18:5146841-5146863 AACAGACCACAGGCCAGATTTGG + Intronic
1153560949 18:6371205-6371227 AACTGGCGGCGGGCCAGATGTGG + Intronic
1153627945 18:7039698-7039720 AACAGGCAGTGTGTCAGATTTGG + Intronic
1154046344 18:10908975-10908997 AACAGGCAGCAGGCAGGATTTGG - Intronic
1154455623 18:14520741-14520763 AACAGGCAGTGGGCTGGATTTGG - Intronic
1154458114 18:14549196-14549218 AAGTGGCAGCAGGCTAGATTTGG - Intergenic
1154507013 18:15051612-15051634 AACAGGAAGCAAGCTAGATTTGG + Intergenic
1155901097 18:31391634-31391656 AACAGACAGCAAGCCAGATTTGG - Intronic
1156086496 18:33411424-33411446 AAAAGGCTGCTGGCCAGATTTGG + Intronic
1156412233 18:36841745-36841767 AACAGCCAGTGGGCCAGATTCGG + Intronic
1156753467 18:40490740-40490762 AACTGACAGCCGGCCAGATTTGG + Intergenic
1157018631 18:43751084-43751106 AACAAGCAACAGGCCAGATTTGG + Intergenic
1157098072 18:44705106-44705128 AACAGGCAGGAGGCTGGATTTGG - Intronic
1157117985 18:44880406-44880428 AAAATGCAGCTGGCTAAATTTGG + Intronic
1157268902 18:46254470-46254492 AACAGGCAGCAGGCCAGAATTGG - Intronic
1157534088 18:48445829-48445851 AACAGGCAACGGACCAGATTTGG + Intergenic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1157938348 18:51897867-51897889 AACAGGCAACTGGCCCGATTTGG + Intergenic
1157995336 18:52547970-52547992 AACAGGCAGTAGGCTGGATTTGG + Intronic
1158011878 18:52737978-52738000 AACAGGCAGAGGGCCAAAGTTGG - Intronic
1158210633 18:55045643-55045665 AACAGGCAGCAGATCAGATTTGG - Intergenic
1158737014 18:60093876-60093898 CACAGGAAGCTGACCAGATGTGG - Intergenic
1158942836 18:62421585-62421607 AACATGGAGCTACCCAGATTGGG - Intergenic
1158947847 18:62463457-62463479 AACAGGCAGCTGGCCTGATTTGG + Intergenic
1159043855 18:63349766-63349788 AACAGGCAGAGGGCCAGATCTGG - Intronic
1159049856 18:63410167-63410189 AACAGGCAGCTGGGCAGCTTTGG + Intronic
1159063713 18:63544230-63544252 AACAGGCAGAGGGCTGGATTTGG + Intergenic
1159193019 18:65072828-65072850 AACAGGGAGCAGGCTGGATTTGG - Intergenic
1160098611 18:75899851-75899873 ACCAGGCAGTAGGCCAGATTTGG - Intergenic
1161696551 19:5771857-5771879 AACAGGAAGATGGCCAGGTATGG - Intronic
1161743992 19:6043522-6043544 AACAGGCAGTGGGCCAGATTTGG - Intronic
1162084200 19:8238596-8238618 AGCAGGCACCAGGCCAGAGTTGG + Intronic
1162427063 19:10603046-10603068 TCCAGGCGGCTGGCCAGACTCGG - Intronic
1162882585 19:13671085-13671107 AACAGGCAGCCAACCAAATTTGG + Intergenic
1162905687 19:13822321-13822343 AACAGGTGGTTGGCCAAATTAGG - Intronic
1163084533 19:14969762-14969784 AGCAGGCAGAGGGCCGGATTTGG - Intronic
1163409172 19:17142835-17142857 AACAAGCATCAGACCAGATTTGG + Intronic
1164451426 19:28369020-28369042 AACAGGCAGAGAGCTAGATTTGG - Intergenic
1164850701 19:31481019-31481041 AATAGGCAGCGGGCCAGATTTGG + Intergenic
1165321178 19:35086214-35086236 AACAGGTGGAGGGCCAGATTTGG + Intergenic
1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG + Intergenic
1166320061 19:42012132-42012154 AATAGACAGCAGGTCAGATTTGG - Intronic
1166540356 19:43601138-43601160 ACCAGGCAGCAGGCTAGAGTTGG - Exonic
1166563993 19:43752434-43752456 AACAGAAAGCAGACCAGATTTGG - Intronic
1167653639 19:50748617-50748639 AACAGGCAGTGCGTCAGATTTGG - Intergenic
1167711013 19:51110935-51110957 AACAGGCAGCAGGCCCGATTTGG + Intergenic
1168015370 19:53568693-53568715 GACAGGGAGCTGGCCAGAAATGG + Intronic
1168349058 19:55665620-55665642 AACAGGCAGTGGGCCAGCGTTGG - Intronic
1168366247 19:55790405-55790427 ACCAGGCAGAGGGCCAGATTTGG + Intronic
1168398809 19:56071237-56071259 AACAGGCGGCTGGCTCCATTTGG + Intergenic
1168411835 19:56145095-56145117 AACAGGCTGCAGGCCAGATTCGG + Intronic
925354945 2:3234069-3234091 AGCAGGCAGCAGGCTGGATTAGG + Intronic
925438044 2:3858395-3858417 AATAGGCAGCTGGCTTTATTTGG + Intergenic
925473126 2:4184186-4184208 ACCAGGCAGCTGGCCAGGTGTGG - Intergenic
925623573 2:5819169-5819191 AATAGGCAGCTGGTCAGTTTTGG + Intergenic
925737196 2:6973762-6973784 AACAGGCAGCAGGCTGGATTTGG - Intronic
926009596 2:9397632-9397654 AACAGGCAGCAGGCTGGATGTGG - Intronic
926254973 2:11185436-11185458 AATAGCCACCTGGCCAGATGCGG + Intronic
926620527 2:15043020-15043042 AACAGGCAGTAGGTCACATTTGG + Intergenic
926944207 2:18169567-18169589 AACAGGCAGTGAGTCAGATTTGG + Intronic
928002046 2:27532206-27532228 AACAGGCAGCATGCTGGATTTGG + Intergenic
928014296 2:27640519-27640541 AACAGGCAGTGGGCTGGATTTGG + Intronic
928140881 2:28727932-28727954 AACAGGCTCCTGGCCACATTTGG - Intergenic
928243475 2:29606628-29606650 AACAGGCAATGGGCCAGATTAGG - Intronic
928470930 2:31574846-31574868 AACAAGCAGTGGGCCATATTTGG - Intronic
928649866 2:33392615-33392637 AATAGGTAGCAGGCCAGATTTGG + Intronic
928819377 2:35342465-35342487 AGCATGCAGATGGCCAGGTTGGG - Intergenic
928983888 2:37161814-37161836 AACAGGCAGCAGCCCAGTTTTGG - Intergenic
928997788 2:37313271-37313293 AACAGGTGGTGGGCCAGATTCGG + Intronic
929031958 2:37657635-37657657 AACAGGCAGGGGGCCGGATTTGG - Intronic
929196433 2:39189605-39189627 AACAGGCAGTAGGCCAGATTTGG - Intronic
929209879 2:39344290-39344312 ATCAGGCAGCAGGCTAGATTTGG - Intronic
929525508 2:42699157-42699179 AACAAGCAGTAGGTCAGATTTGG - Intronic
929987992 2:46756467-46756489 AACAGGCCACAGGCCAGATTTGG + Intronic
930022568 2:47010344-47010366 AATAGGCAGAGGGCCAGATTTGG + Intronic
930165213 2:48197541-48197563 AATAGGCAATGGGCCAGATTTGG - Intergenic
930241494 2:48940170-48940192 AACAGGTAGTAGACCAGATTTGG + Intergenic
930353830 2:50292111-50292133 AAGAGGCAGTGGGTCAGATTTGG - Intronic
931001184 2:57784414-57784436 AACAGGCAGTGAGTCAGATTTGG + Intergenic
931013277 2:57943998-57944020 GACAGGCACTGGGCCAGATTTGG + Intronic
931106621 2:59063716-59063738 AACAGGCAGTGGGGTAGATTTGG - Intergenic
931119926 2:59205086-59205108 AACAGGCATCAGGTCTGATTTGG + Intergenic
931635307 2:64335596-64335618 AACAGGAAGAAGGCCAGATTTGG + Intergenic
931765617 2:65453416-65453438 AATAAGCAGCTGGCTAGATCCGG - Intergenic
931800134 2:65750096-65750118 ACCAGGCGGTGGGCCAGATTTGG + Intergenic
932064789 2:68543358-68543380 AAAAAGCAGTAGGCCAGATTTGG + Intronic
932375796 2:71234709-71234731 AGCTGTCAGCTGGCCGGATTTGG + Intergenic
932417416 2:71581824-71581846 AGCAGGCAGAGGGCCAGATTTGG - Intronic
932429293 2:71664383-71664405 AACAGGCTGCTGTCCAAGTTTGG + Exonic
932529839 2:72517336-72517358 AACAGGCAACAGGCTGGATTTGG + Intronic
932806738 2:74791060-74791082 AACAGGCAGCAGGCTGGATTTGG + Intergenic
932848153 2:75155900-75155922 AATAGGCAGCAGGCCAGCTTTGG - Intronic
932858425 2:75263459-75263481 AACAGGTGGCAGGCCAGGTTTGG - Intergenic
932924714 2:75959642-75959664 ATCCCACAGCTGGCCAGATTTGG + Intergenic
933189523 2:79318670-79318692 AACAGGCAGCAGGCTAGATTTGG - Intronic
933259143 2:80112163-80112185 AACAGGTAGCCAGCCAGATGAGG - Intronic
933259244 2:80113521-80113543 AACAGGTGGTGGGCCAGATTTGG - Intronic
933396202 2:81734368-81734390 AATAGTCAGTGGGCCAGATTTGG + Intergenic
933462523 2:82607175-82607197 AACAGGCAACAAGCTAGATTTGG - Intergenic
933627564 2:84618962-84618984 AACAGGTGGTGGGCCAGATTTGG + Intronic
933979036 2:87535719-87535741 AACAGGCAGAGGGCCAGATTTGG + Intergenic
934648806 2:96075576-96075598 AGCAGGCAGCAGGTCAAATTTGG + Intergenic
934757016 2:96831492-96831514 AATAGGCTGCTAGCCAGATGTGG - Intronic
934862672 2:97777417-97777439 AACAGACTGCAGGCCAGATTTGG - Intronic
935205544 2:100893720-100893742 AACAGGTTGTGGGCCAGATTTGG - Intronic
935511802 2:103985037-103985059 AACAGGCAGTGGGGCAGAATTGG - Intergenic
935890655 2:107674368-107674390 AACATGGTGCTGGCCAGATAGGG - Intergenic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
936314791 2:111415073-111415095 AACAGGCAGAGGGCCAGATTTGG - Intergenic
936959205 2:118055969-118055991 TCCAGGCAGCTGGCCTGATGAGG - Intergenic
936986717 2:118318084-118318106 AACAGGAAGAGGGCTAGATTTGG + Intergenic
937177303 2:119952715-119952737 ACAAGTCAGCTGTCCAGATTGGG - Intronic
937238609 2:120445967-120445989 AACAGGCAGGGGGCTGGATTTGG + Intergenic
937636342 2:124159454-124159476 AATAGGTGGCAGGCCAGATTTGG + Intronic
938096190 2:128465707-128465729 ATCAGGCAGCAGGACAGATGAGG - Intergenic
938256472 2:129863423-129863445 CACAGCCAGTGGGCCAGATTGGG - Intergenic
938284466 2:130097962-130097984 AACAGGCAGTGGGCTGGATTTGG - Intronic
938335104 2:130486528-130486550 AACAGGCAGTGGGCTGGATTTGG - Intronic
938354721 2:130634141-130634163 AACAGGCAGTGGGCTGGATTTGG + Intronic
938431141 2:131240929-131240951 AACAGGCAGTGGGCTGGATTTGG + Intronic
938475925 2:131613170-131613192 AACAGGCAGTGGGCTGGATTTGG + Intergenic
938748261 2:134302196-134302218 AACAGGCAGTGGGCCAGATTTGG + Intronic
938837763 2:135124771-135124793 AATAGGCTAATGGCCAGATTTGG - Intronic
939259345 2:139787140-139787162 AACAGGCAGCATGCCCGATTTGG - Intergenic
939457766 2:142460597-142460619 AACAGGCAGCTAGCTAAATTTGG + Intergenic
939659513 2:144870789-144870811 AATAGTCAGTGGGCCAGATTTGG + Intergenic
939734032 2:145821053-145821075 AATAGGCAGCAGTCAAGATTTGG - Intergenic
940061327 2:149572948-149572970 AACAGGCACCGGATCAGATTTGG - Intronic
940153131 2:150624905-150624927 AACAGGAAGCTGGTTGGATTTGG - Intergenic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
940450753 2:153833722-153833744 AACAAGCAGCAGGCCAGATTTGG + Intergenic
940663415 2:156575726-156575748 AGCAAGCAGATGGCTAGATTAGG + Intronic
940756857 2:157693184-157693206 AACAGACAGTGGGCCATATTTGG + Intergenic
940793507 2:158052932-158052954 AACAGGCATTGGGTCAGATTTGG + Intronic
940807335 2:158202815-158202837 AACAGGCAGAGGGCCAGATATGG + Intronic
941641458 2:167993394-167993416 AACATGCAGTTGGCCAGGTGTGG + Intronic
941677483 2:168359241-168359263 AACAGACAGCAAGCCAGATTAGG - Intergenic
942040732 2:172059675-172059697 AACAGTCAGCAGTCCAGATTTGG + Intronic
942289973 2:174459143-174459165 AACAGGTGGTGGGCCAGATTTGG + Intronic
942936745 2:181566382-181566404 AACAGGCACCAGGACAAATTGGG - Intronic
943626319 2:190205036-190205058 AACAGGCAGCAGGCTGGATTTGG + Exonic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
943763732 2:191637735-191637757 GACAGGCAGCTGGACAGAGAAGG + Intergenic
944184980 2:196937883-196937905 AACATGCTGTAGGCCAGATTTGG + Intergenic
944487580 2:200223006-200223028 AACAGGCAGCGGGCCAGGTTTGG + Intergenic
944508663 2:200442456-200442478 AAAAGGCTGTGGGCCAGATTTGG + Intronic
945044730 2:205771923-205771945 AACAGGCAGTGGGCTGGATTTGG + Intronic
945575062 2:211520430-211520452 AACAGGCCACGGGCTAGATTTGG - Intronic
945712196 2:213312022-213312044 ATCAGGAAGCAGGCCAGATTTGG - Intronic
946175534 2:217919908-217919930 AACAGGCACCTGGCCAGGCCTGG + Intronic
946350703 2:219149913-219149935 AACAGGCAGCAAGCCAGAATTGG + Intronic
946600402 2:221353925-221353947 CACAGGCTGAAGGCCAGATTTGG - Intergenic
946626373 2:221615858-221615880 AACAGGCTGTGGGCCAGATTTGG + Intergenic
946842100 2:223829289-223829311 AACAGGCAGAAGGCCAGATTTGG - Intronic
947111893 2:226727455-226727477 AACAGGCAGCAGGCTGGATTTGG + Intergenic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
947249182 2:228082112-228082134 AACAGGCAGTGGCCCAGATTTGG + Intronic
947430034 2:230019914-230019936 ATCAGGAGGCTGGTCAGATTAGG - Intergenic
947635317 2:231677750-231677772 AACAGGAAGGTGGCCAGACAAGG - Intergenic
947898127 2:233694277-233694299 AACAGGCCTTTGGGCAGATTGGG - Intronic
948143887 2:235694051-235694073 ATCGGGAAGCTGGCCAGATGTGG + Intronic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
948240706 2:236430995-236431017 AACAGGCACCAGGCCAGATTTGG - Intronic
948275859 2:236708126-236708148 AACAGCCAGTGGGCCAGATTTGG + Intergenic
948412881 2:237778379-237778401 CACAGGCAGCAGGGCAGAGTGGG - Intronic
948723134 2:239913777-239913799 AACATGCAGCCTGCCAGATGGGG - Intronic
948882660 2:240868360-240868382 AGCAGGTGGCAGGCCAGATTGGG - Intergenic
948931633 2:241135948-241135970 TCCAGGCAGCTGGCCAGGTCTGG + Exonic
1168866224 20:1089329-1089351 AACAAGCAGCAGGCCAGATTTGG + Intergenic
1169040137 20:2487034-2487056 AACAGGCAGTGAGACAGATTTGG + Intronic
1169104018 20:2978844-2978866 AACAGGCAGTGGGCTAAATTTGG + Intronic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1169175652 20:3510436-3510458 AGCAGACAGCAGGCCTGATTTGG + Intronic
1169419539 20:5448963-5448985 TACAGGCAGCTGACCAGACTCGG + Intergenic
1169672867 20:8123607-8123629 AACAGGTAGCAGGCTGGATTTGG - Intergenic
1169796952 20:9473393-9473415 TGCAGGCAGCTAGCCAGCTTTGG + Intronic
1169809030 20:9590387-9590409 AACAGGCAGAGGGCCAGATTTGG - Intronic
1169837910 20:9900941-9900963 AAGAGGCAGCAGGCCAGATTTGG - Intergenic
1170067743 20:12332683-12332705 AACAGGCAGCATCCCAGACTTGG - Intergenic
1170092949 20:12612523-12612545 AAGAGGCAGCAGGCCAGGTTTGG - Intergenic
1170108135 20:12774383-12774405 AATAGGCTGCAGGCCAGATATGG + Intergenic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170497286 20:16938426-16938448 AACAGGAAGTGGGCCAGATTTGG - Intergenic
1170621555 20:18000593-18000615 ATCAGGCAGCAAGCCGGATTTGG - Intronic
1170853345 20:20023982-20024004 AACAGGCAGTGGGCCAGATTTGG - Intronic
1171040913 20:21762807-21762829 AACAAGCAGCAGGCTGGATTTGG - Intergenic
1171177479 20:23063521-23063543 AACAGGCAGTGGGCCAGAGTGGG + Intergenic
1171568523 20:26220980-26221002 CACAGGCAGCAGACCAGATCTGG + Intergenic
1172512161 20:35508278-35508300 AACAGGCAGCAGGCTGGATTTGG - Intronic
1172972628 20:38884556-38884578 AACAGGCTGCCTGCCAGATTTGG + Intronic
1173102752 20:40102790-40102812 AACAGGAAGCAGGCTGGATTTGG + Intergenic
1173150674 20:40564159-40564181 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1173159623 20:40642808-40642830 AAAAGGCAGTAGGCCACATTTGG + Intergenic
1173299832 20:41792405-41792427 AACTGGTGGCAGGCCAGATTTGG + Intergenic
1173325367 20:42027979-42028001 ATCAGGCAGAGGGCCAGATTTGG + Intergenic
1173403839 20:42748028-42748050 AACAGGCAGAGGGCTGGATTTGG - Intronic
1173415518 20:42851801-42851823 AACAAGCAGCAAACCAGATTTGG + Intronic
1173447957 20:43137313-43137335 AAAAGGCAGAGGGCCAGATCTGG - Intronic
1173451107 20:43164891-43164913 AACAGGCAGCAGGCCAGATCTGG + Intronic
1173454850 20:43193611-43193633 AACAGGCAGTGGGCCAGATGTGG - Intergenic
1173454865 20:43193764-43193786 AATAGGCAGTGGTCCAGATTTGG - Intergenic
1173953165 20:47009054-47009076 AACAGGCAGTGGACCAGATTTGG + Intronic
1173969626 20:47142197-47142219 AACAAGCAGCAGGCCAGGTATGG + Intronic
1173971993 20:47160400-47160422 AACAGGCGACAGGCCAGATTTGG + Intronic
1174190053 20:48734217-48734239 AACAGGCAGAGGGCCAGATTAGG - Intronic
1174219767 20:48944833-48944855 AGCAGACAGTAGGCCAGATTTGG - Intronic
1174543732 20:51309289-51309311 AACAGGCAGTGGGCCATATTTGG - Intergenic
1174645601 20:52082713-52082735 AACAGGTGGCAGGCTAGATTTGG - Intronic
1174675068 20:52345705-52345727 CACAGGAAGCAGGCTAGATTTGG + Intergenic
1174681346 20:52411748-52411770 AACAGGTGGCTGGCTGGATTTGG - Intergenic
1174763004 20:53225126-53225148 AACAGGCAGTGGGTCAGATTTGG + Intronic
1174792906 20:53497130-53497152 AACAAGTAGCAGGCCAAATTTGG + Intergenic
1174911432 20:54612198-54612220 AACAGTCAGCAGGCTGGATTTGG + Intronic
1174937889 20:54892520-54892542 AACAGGCAGCAGACCTAATTCGG - Intergenic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175148535 20:56914732-56914754 AGCAGACAGCTGGCAGGATTTGG + Intergenic
1175376629 20:58530982-58531004 AACAGGCGGTGGGCTAGATTTGG + Intergenic
1175435198 20:58942092-58942114 AACAGGTGGCAGGCCAGATTTGG + Intergenic
1175451002 20:59068019-59068041 AACAGAGAGCTGGCCAGATTTGG - Intergenic
1175581459 20:60102987-60103009 ATCAGGCAGTGGGCCAGATTTGG - Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1175763278 20:61575603-61575625 TACAGGCAGAGGGCCAGATATGG - Intronic
1175779731 20:61674856-61674878 AATAGGCAGGGGGCCAGACTTGG - Intronic
1176409048 21:6437824-6437846 AACATGAAGCTGGCCAGGCTTGG + Intergenic
1176790861 21:13317485-13317507 AACAGGAAGCAAGCTAGATTTGG - Intergenic
1176816042 21:13604108-13604130 AAGTGGCAGCAGGCTAGATTTGG + Intergenic
1176818544 21:13632578-13632600 AACAGGCAGTGGGCTGGATTTGG + Intronic
1177310109 21:19379678-19379700 AACAGGCTGTAGGCTAGATTTGG - Intergenic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177535446 21:22421380-22421402 GACAGGTAGCAAGCCAGATTTGG - Intergenic
1177607986 21:23407156-23407178 AACAGGCAGCAAGCCAGATTTGG + Intergenic
1177865854 21:26512543-26512565 AACAGGCAGCAGACCAGATCTGG - Intronic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1177990928 21:28035883-28035905 AACAGGAAGCAAGCTAGATTTGG + Intergenic
1178573099 21:33759229-33759251 AACAGGCAGTGGGCCAGATCTGG + Intronic
1178604023 21:34019535-34019557 AACAGGCAATGGGCCAGATTTGG - Intergenic
1178614735 21:34122265-34122287 TACAGGTAGCAAGCCAGATTTGG + Intronic
1178692177 21:34759230-34759252 ACCCAGCAGCCGGCCAGATTGGG - Intergenic
1178724715 21:35040890-35040912 AGCAGTCAGCTTGCCAGATGGGG - Intronic
1178737962 21:35169733-35169755 AACAGACAGTGGGCCTGATTTGG - Intronic
1178891824 21:36526308-36526330 AACAGGCAGCAGGGCAGGTTTGG + Intronic
1178926211 21:36777406-36777428 AACTGGCAGCAGGCCAGACTCGG + Intronic
1179177255 21:39017539-39017561 AAGAGGCGGCAGGCTAGATTCGG + Intergenic
1179182051 21:39053889-39053911 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1179184886 21:39077976-39077998 AACAGACAAAGGGCCAGATTTGG + Intergenic
1179393326 21:41013806-41013828 AACAGGCAGCTGGCCAAACTTGG + Intergenic
1179411140 21:41164260-41164282 AACAGGCAGTTGGCCAGATTTGG + Intergenic
1179415490 21:41195081-41195103 AACAGGTAGCTGGCCAGATTTGG - Intronic
1179420739 21:41234386-41234408 AACAGGCAGCAGGTCAGATTTGG - Intronic
1179684540 21:43046146-43046168 AACATGAAGCTGGCCAGGCTTGG + Intergenic
1179943873 21:44657506-44657528 AACAGGCAGTGGGCCAAATGTGG + Intronic
1180282400 22:10714663-10714685 AACAGGCAGAAGACCAGATCTGG - Intergenic
1180608650 22:17081288-17081310 AACAGGCAGTAGAACAGATTTGG - Intergenic
1181005102 22:20009548-20009570 GACAGGCAGATGGCCAGGGTGGG + Intronic
1181505701 22:23355268-23355290 AAAAGACAGTGGGCCAGATTTGG - Intergenic
1182010018 22:26992851-26992873 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182261748 22:29077675-29077697 AACAGGCAGTGAGCCAGATCTGG + Intronic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
1182652020 22:31859728-31859750 ATCAGAGGGCTGGCCAGATTTGG + Intronic
1183026740 22:35070996-35071018 AACAGGGGTCAGGCCAGATTTGG + Intronic
1183028179 22:35082181-35082203 GACAGACAGTGGGCCAGATTTGG + Intronic
1183755051 22:39754220-39754242 AACAGGCAGTGAGCCAGATTTGG + Intronic
1183787317 22:40037432-40037454 AACAGGCAGTGGGCTGGATTTGG + Exonic
1184621759 22:45684413-45684435 AACAGGTAGTAGGCCAGATCTGG - Intronic
1184677234 22:46050368-46050390 CACAGGCAGCTGGGCATGTTGGG + Exonic
1185098228 22:48823015-48823037 AGCAAGCAGTGGGCCAGATTTGG - Intronic
949121661 3:391955-391977 AACAGGCAGCAGGCTGAATTTGG - Intronic
949168991 3:976232-976254 AACAGGCGGCCTGCCAAATTTGG + Intergenic
949345593 3:3073379-3073401 AACAGGCAACAAGCCAGATTTGG - Intronic
949867218 3:8555945-8555967 AACAGGCGGTGGGCTAGATTTGG + Intronic
950159380 3:10748249-10748271 AACAGGCAGTGGGCCAGATTTGG + Intergenic
950193038 3:10991574-10991596 AGCAGGGAGGAGGCCAGATTAGG + Intergenic
950434554 3:12970980-12971002 AACAGGCAGCAGGCTGGACTTGG - Intronic
950871876 3:16236460-16236482 CACAGGTGGTTGGCCAGATTTGG + Intergenic
951055850 3:18145566-18145588 AACAGGCAGCAGGCCCCGTTTGG - Intronic
951098364 3:18657904-18657926 AACAAGCAAATGGGCAGATTGGG - Intergenic
951106910 3:18755055-18755077 AACAGGCAGTAGGCCATATTTGG - Intergenic
951258180 3:20475373-20475395 AACTGTCAGCAGACCAGATTAGG + Intergenic
951501598 3:23393709-23393731 AACAGGTAGTCGGCCAGATGTGG - Intronic
951571576 3:24069215-24069237 AACAGGTGGCGGGCCAGATTTGG - Intergenic
951587114 3:24226777-24226799 AACAGGCAGCAGGTCAGCTTTGG - Intronic
951615701 3:24541137-24541159 AACAGGCAGTGGGCCAGGTTTGG + Intergenic
951634587 3:24759164-24759186 AACAGGTGGCAGACCAGATTTGG - Intergenic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
951801520 3:26601890-26601912 AACAAGCAGCAGGCAATATTTGG - Intergenic
951883378 3:27501155-27501177 AACAGGCAGCTGGTCAGTTTTGG - Intergenic
952037389 3:29219453-29219475 AACAGGTGGCAGGCCAGATTTGG + Intergenic
952147907 3:30553485-30553507 AATAGGCAAAGGGCCAGATTTGG + Intergenic
952240215 3:31524488-31524510 AACAGGCAGCAAACCAGATTCGG - Intergenic
952326048 3:32321573-32321595 AACAGGCAGCAGGCATGATCTGG - Intronic
952337075 3:32413042-32413064 AACAGGTGGCAGGCCAGATTTGG - Intronic
952353629 3:32564380-32564402 AACAGGCAGCAAGCCAGTTTTGG - Intronic
952464183 3:33563683-33563705 AACAGGCAGCAGGGAAGATGTGG + Intronic
953482158 3:43261067-43261089 AACAGGCAGCTTGTGAGTTTAGG - Intergenic
953499443 3:43418849-43418871 AACAGGCTGTAGGCCAGTTTTGG - Intronic
953939488 3:47079769-47079791 AACAGACAGTGGGGCAGATTTGG + Intronic
954481291 3:50803814-50803836 AAGGGGCAGCTGGCCGGGTTGGG + Intronic
954953022 3:54491642-54491664 AACAGGCAGCTGGCAGGACATGG - Intronic
954970540 3:54648178-54648200 AGCAGGCAATGGGCCAGATTTGG - Intronic
954975036 3:54685424-54685446 AACTGGCAGTGGGCCAGATTTGG + Intronic
954975110 3:54686144-54686166 AATAGGCAGCAGGCCAGACTTGG - Intronic
955037930 3:55286946-55286968 AAAGGGCAGCAGGCCAGATTTGG + Intergenic
955139892 3:56258698-56258720 ACCAGGGAGCTGGCTGGATTTGG + Intronic
955144733 3:56305767-56305789 AGCAGGCAAAAGGCCAGATTTGG - Intronic
955310587 3:57882667-57882689 AACAGGCAGCAGGTTGGATTTGG + Intronic
955412554 3:58665178-58665200 GACAGGCAGATGCACAGATTTGG + Intronic
955422777 3:58755865-58755887 AACAGGCAGTGGGCCAGACTTGG - Intronic
955511833 3:59688840-59688862 AACAGGCTGTGGGCCAAATTTGG + Intergenic
955591723 3:60543233-60543255 AACAGGCAGCAGCCCAGATTTGG + Intronic
955666991 3:61360307-61360329 ACCAGACAGCTGGCCAGATTTGG + Intergenic
955690822 3:61589020-61589042 AATAGGCAGTGGGCCAGACTGGG - Intronic
955830308 3:62994520-62994542 AACAGTCCACAGGCCAGATTTGG + Intergenic
955894642 3:63686351-63686373 AATAGGCAATGGGCCAGATTTGG + Intergenic
955956070 3:64291581-64291603 AATAGGCTGAGGGCCAGATTTGG + Intronic
956013343 3:64854992-64855014 AACAGGCAGTGGGTCAGATTTGG - Intergenic
956013670 3:64858559-64858581 AACAGGTAGTGGGTCAGATTTGG + Intergenic
956103915 3:65796875-65796897 AACAGGCTGTGGGTCAGATTTGG + Intronic
956200620 3:66701826-66701848 AACAGGTGGCAGGCCAGATTTGG - Intergenic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
956371053 3:68562222-68562244 AACAAGCAGCAAGCCAGATTTGG + Intergenic
956430706 3:69183355-69183377 AACAGGCAGCAGGATGGATTTGG + Intronic
956509134 3:69976215-69976237 AACAAGTGGCAGGCCAGATTTGG + Intergenic
956552411 3:70476281-70476303 AGCAGGTGGCGGGCCAGATTTGG - Intergenic
956686412 3:71832691-71832713 AACTGGCAGCAGGCTAGATTTGG - Intergenic
956721175 3:72118875-72118897 CAGAGGCAGCAGGCCAGATTTGG - Intergenic
956732926 3:72213454-72213476 AACAGGCTGCAGGCCAAATTCGG - Intergenic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
956856328 3:73278532-73278554 AACAGGCAGTGGACCAGATTTGG + Intergenic
956865499 3:73364992-73365014 AACAGGCATCAGGCTGGATTTGG - Intergenic
956903910 3:73745603-73745625 AACGGGCAGTGGGCCAGATTTGG - Intergenic
956991233 3:74768215-74768237 AACAGGCAGCAGGCTGGATTTGG + Intergenic
956992276 3:74780868-74780890 AGCAGAGAGTTGGCCAGATTTGG + Intergenic
957066182 3:75524325-75524347 AACAGTCAGAGGGCCAGATTTGG - Intergenic
957110326 3:75947377-75947399 AACAGGCAGCAGGCCAGATCTGG - Intronic
957251672 3:77779548-77779570 AAGTGGCAGCAGGCTAGATTTGG - Intergenic
957541741 3:81579965-81579987 AACAGGCAGCAGGTAGGATTTGG + Intronic
957551115 3:81706200-81706222 AACAGGTAGTGGGCCAGATTTGG + Intronic
957832072 3:85534485-85534507 AATAGGCAGTGGGCTAGATTTGG - Intronic
958267507 3:91456654-91456676 AACAGGCAGCCGTCTGGATTCGG - Intergenic
958726640 3:97913634-97913656 AACAAGCAGTGGGGCAGATTTGG + Intronic
958982936 3:100745776-100745798 AACAGGCAATAGTCCAGATTTGG - Intronic
958986370 3:100783819-100783841 AACAGGCAGTGAGCCAGATTTGG + Intronic
959627224 3:108466121-108466143 AACAGGCTGCAGGCTAGATTGGG + Intronic
959890753 3:111552673-111552695 AATAGGCAACAAGCCAGATTTGG + Intronic
959945571 3:112122379-112122401 AACAGGGAGTGGGCTAGATTTGG + Intronic
960086925 3:113601412-113601434 AACAGGTGGCAGGCTAGATTTGG + Intronic
960135857 3:114104044-114104066 AACAGGCAGAGGGCTGGATTTGG - Intergenic
960263655 3:115595979-115596001 AATAGGTAGCAGGCCAAATTTGG - Intergenic
960507155 3:118507706-118507728 AACCGGTAGCAGGCTAGATTTGG + Intergenic
960670459 3:120150844-120150866 AACAGGCAGCAGGCTAGATTTGG + Intergenic
960765577 3:121126211-121126233 AACAGGCAGCATGCCAGATTTGG - Intronic
960825756 3:121782474-121782496 AACAGGCAGCAGGCTGGATTTGG - Intronic
960980838 3:123224204-123224226 AATAGTCAGCAGGCTAGATTTGG + Intronic
961286961 3:125813714-125813736 AACAGTCAGAGGGCCAGATTTGG + Intergenic
961472328 3:127123710-127123732 AATAGGCAACAGGCCAGATTTGG + Intergenic
961776016 3:129286117-129286139 AACAGGCAGTAGGCCAGATTTGG - Intronic
961997418 3:131260469-131260491 AACAGGCAGTGAGACAGATTTGG - Intronic
962130570 3:132669661-132669683 AACAGGTGGTGGGCCAGATTTGG + Intronic
962208678 3:133457656-133457678 AACAGGCAATGGGTCAGATTTGG - Intronic
962225408 3:133602782-133602804 AATAGGCAGTGGGCCAGGTTTGG + Intronic
962502169 3:136006584-136006606 AACAGGCAGTGGGCCAGATTTGG + Intronic
963081415 3:141398135-141398157 AACAGGTATCAGGCCAGATGTGG + Intronic
963203707 3:142611219-142611241 AGCAGGCAGTGGACCAGATTTGG + Intronic
963808304 3:149748767-149748789 AATAGGTAGCAAGCCAGATTTGG + Intronic
964081226 3:152760461-152760483 AACAGGCAGCTGGGTAGATTTGG - Intergenic
964361518 3:155902364-155902386 AACAGGTGGTAGGCCAGATTTGG - Intronic
964441964 3:156721069-156721091 GATAGGCAGCAGGCCAGATTTGG + Intergenic
964765727 3:160177108-160177130 AACAGGCAGAAGTCCAGATTTGG - Intergenic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966005989 3:175012626-175012648 AACAGGTGGTGGGCCAGATTTGG - Intronic
966384087 3:179376689-179376711 AGCTGGCAGCTGGCTAGATTTGG + Intronic
966425566 3:179776277-179776299 AACAGGTTGTGGGCCAGATTTGG + Intronic
966549380 3:181187326-181187348 AACAGGCAGTGAGCCAGATTTGG + Intergenic
966672518 3:182543729-182543751 AATAGGCAGCAGGCTAGATTTGG + Intergenic
966702348 3:182868694-182868716 AACATGGAGCTGGGCAGATCTGG + Intronic
966954234 3:184857261-184857283 AACAGACGGCTGGCCAGATTTGG - Intronic
967654660 3:192032578-192032600 AACAGGCAGTGGGCTAAATTTGG - Intergenic
967696345 3:192536129-192536151 AACAGGCAGTTTGCTGGATTTGG - Intronic
967798681 3:193629201-193629223 AAAAGACAGCTGGCCAGGTGCGG - Intronic
968167041 3:196474851-196474873 AACAGGCAGGAGGCTGGATTTGG - Intronic
969230108 4:5824575-5824597 AACAGGCGGTGGGCCGGATTTGG - Intronic
969230551 4:5827302-5827324 CACAGGCAGCAGGCCATATGAGG - Intronic
969743274 4:9049481-9049503 TACAGTCAGAGGGCCAGATTTGG + Intergenic
969802653 4:9581580-9581602 AACAGTCAGAGGGCCAGATTTGG + Intergenic
970108183 4:12608756-12608778 TACAAGCACCTGGCCAGATTTGG - Intergenic
970568631 4:17357418-17357440 AATAGGTAGCAGGCCAGATTTGG - Intergenic
970958599 4:21845452-21845474 AACAGGTGGTGGGCCAGATTTGG + Intronic
971092169 4:23358580-23358602 AACAGTCAGCAAGCTAGATTTGG - Intergenic
971190328 4:24422093-24422115 AACAGACAGTGGGCCGGATTTGG - Intergenic
971462907 4:26921557-26921579 AACAAGCAGCCAGCCATATTTGG + Intronic
971588748 4:28439644-28439666 AACAGTCAGCGTGCTAGATTTGG - Intergenic
971820826 4:31552288-31552310 AACAGGATGCATGCCAGATTTGG + Intergenic
971821928 4:31568298-31568320 AACAGGCAGTCAGCCGGATTTGG + Intergenic
972124715 4:35748932-35748954 AATGGGCAGCTAGCCAGATTTGG - Intergenic
972197962 4:36676880-36676902 AACAGGCAGCAGACTGGATTTGG + Intergenic
972297017 4:37749149-37749171 AACAGGCAGCAGACCCTATTTGG - Intergenic
972586726 4:40444361-40444383 AACAAACAGCAGGCCATATTTGG - Intronic
972715493 4:41641894-41641916 AACTGGCTTCTGGCCACATTTGG + Intronic
973278644 4:48336152-48336174 AACAGCAAGTTTGCCAGATTTGG - Intergenic
973685794 4:53368317-53368339 AACAAGCAGATGGACAGAGTGGG + Intergenic
973775611 4:54238673-54238695 AACAGGTTGCAGGCCAGGTTTGG + Intronic
974061819 4:57042272-57042294 AACAGATGGCAGGCCAGATTTGG - Intronic
974120661 4:57634092-57634114 AACAGGTGGTAGGCCAGATTTGG - Intergenic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
975455808 4:74588566-74588588 AACAGGCAGTGGGCAGGATTTGG + Intergenic
975943243 4:79673614-79673636 AACAGGTCGTAGGCCAGATTTGG + Intergenic
976084146 4:81389926-81389948 AACAGGCAGCAGGCCAGACTTGG + Intergenic
976087915 4:81425237-81425259 AACAAGCAGCTGGCTAGATCTGG + Intergenic
976121328 4:81785594-81785616 AACAGGAAGCTGGCCACATTTGG + Intronic
976126260 4:81836552-81836574 AACAGGCAATCGGCCAGATTTGG + Intronic
977184604 4:93921100-93921122 AGTAGGCAGCAGGCCAGAGTTGG + Intergenic
977500296 4:97828855-97828877 AAAAGGCAGCTGCCCTGGTTAGG + Intronic
978509189 4:109497049-109497071 AACAGGCAGTGGGCCCGATTTGG - Intronic
978625558 4:110680858-110680880 AACAGAAAGCTGGCTAGACTTGG - Intergenic
978750264 4:112238087-112238109 AATAGGCAGAGGGCCAGATTTGG + Intronic
978945166 4:114486687-114486709 AACAGGCTGCAGGCTGGATTTGG + Intergenic
979357752 4:119725473-119725495 AACAGGCAGCAGGCTGGATTTGG - Intergenic
979693971 4:123590809-123590831 AACAGGCAGTGGGTCAGATTTGG + Intergenic
979934705 4:126677031-126677053 AACAGGTAGCAGGCCAGATTTGG + Intergenic
979975736 4:127194197-127194219 AACAGGAAGCGGGCCAAATTTGG + Intergenic
980213937 4:129826866-129826888 AACAGGCGGTAGGCCAGATTTGG - Intergenic
980331518 4:131416237-131416259 AGCAGGCTGCTGGCCAGCTCAGG - Intergenic
980544634 4:134243937-134243959 AGTAGGCAGCAGACCAGATTTGG + Intergenic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
981131092 4:141159459-141159481 AACAAGCAGCAGACAAGATTTGG + Intronic
981690064 4:147498474-147498496 AACAGGTGGTGGGCCAGATTTGG - Intronic
982050551 4:151497369-151497391 AACAGGTGACTGGCCAAATTTGG - Intronic
982091866 4:151886996-151887018 AGTAGGCAGCTGGCTGGATTGGG - Intergenic
982235184 4:153245476-153245498 AACAGGCCGTGGGCCAGATTTGG - Intronic
983278225 4:165644729-165644751 AAAAGGCAGCTGGTCAGAGCGGG - Intergenic
983528265 4:168782952-168782974 AGCAAGCAGTGGGCCAGATTTGG + Intronic
983671976 4:170247831-170247853 GACAGGCAATAGGCCAGATTTGG - Intergenic
984000738 4:174239981-174240003 AGCAGGCAGCAGGCCAGATCTGG - Intronic
984183131 4:176509599-176509621 AACAGGCAGTGGGCTAGATTTGG - Intergenic
984446475 4:179842981-179843003 AACAGGTGGCTTGACAGATTTGG + Intergenic
984916449 4:184729608-184729630 AACAGGTGGCAGGCTAGATTTGG + Intronic
984923338 4:184785045-184785067 AACAGCCAGTGGGCCTGATTTGG - Intronic
985858653 5:2451318-2451340 AGCAGGCAGCTGGCCAGATTTGG + Intergenic
986341092 5:6790048-6790070 AACAGGCAACAGGTCAGATTTGG - Intergenic
986448874 5:7847602-7847624 AATAGGCAACTGGCCAGATTTGG + Intronic
986478012 5:8155315-8155337 AACAGGTAGTAGGCCATATTGGG - Intergenic
986606153 5:9525120-9525142 AAGAAGCAGTGGGCCAGATTTGG - Intronic
986614243 5:9600394-9600416 AACAGGAGGCTGACCGGATTTGG - Intergenic
986986583 5:13507156-13507178 AACAGGAAGGTGCCCTGATTTGG - Intergenic
987040741 5:14059990-14060012 AACAGGAGGTGGGCCAGATTTGG - Intergenic
987185149 5:15409898-15409920 AACTGCCAGCGGGCTAGATTTGG + Intergenic
987285741 5:16454675-16454697 AACAGGCGGTTGGCCAGATTTGG - Intronic
987287431 5:16471073-16471095 AACAGGTAGCAGGCCAGATTTGG + Intergenic
987419853 5:17706696-17706718 AACAGACAGTGGGCCAGATTTGG - Intergenic
987421999 5:17731170-17731192 AATAGGTGGCAGGCCAGATTTGG + Intergenic
987925986 5:24342534-24342556 AACAGGCAGCTAGCTGGGTTTGG - Intergenic
988227783 5:28435075-28435097 ATCAGGAAGCTGGCATGATTGGG - Intergenic
988428901 5:31095952-31095974 AACAGATGGCTGGCCTGATTTGG - Intergenic
988555583 5:32233137-32233159 AACAGGCGCCAGGCCAGATTTGG - Intronic
988721145 5:33880527-33880549 AACAAGAGGCAGGCCAGATTTGG + Intronic
989080408 5:37613948-37613970 AACAGGTAGTGGGCTAGATTTGG - Intronic
989468703 5:41789292-41789314 AATAGGCAGTGGGCCAGATTTGG + Intronic
990723506 5:58726477-58726499 AACAAGCAGTGGGCCAGATTTGG - Intronic
990958160 5:61364365-61364387 AACAGGTGGCAGGCCAGATTTGG - Intronic
990980509 5:61598628-61598650 AGCAGGCAGCAGACCAGATTTGG - Intergenic
990999358 5:61767394-61767416 ATGAGGCAGCTGGGCAGTTTTGG + Intergenic
991141304 5:63247049-63247071 AACAGGCAGGAGACCAGATGTGG - Intergenic
991345727 5:65665199-65665221 AAGAGGCAGCTGGGCAGATTTGG + Intronic
991686989 5:69190285-69190307 AATAGGCAGTTAGGCAGATTTGG - Intronic
992035637 5:72772541-72772563 AACAGGTGGCAGGCCAGATTAGG + Intergenic
992243912 5:74797978-74798000 ACCAGGTGGCAGGCCAGATTTGG + Intronic
992570016 5:78045893-78045915 AATAGGCAGCAGGCCATATTTGG - Intronic
992594087 5:78328028-78328050 AACAGGCATTGGGCCAGATTTGG + Intergenic
992858238 5:80886123-80886145 AATGGGCAGTGGGCCAGATTTGG - Intergenic
993090167 5:83415801-83415823 AACAGGCTGCGGGCCAGATTTGG - Intergenic
993179796 5:84538030-84538052 TACAGGCATCTGACCATATTTGG - Intergenic
993575939 5:89600938-89600960 AACAGGCAGTAGGGCAGATCTGG + Intergenic
994877980 5:105450000-105450022 AAGAGTCAGCTAGCCACATTAGG - Intergenic
994900894 5:105767878-105767900 GACAGGCATCAGGCCAGATTTGG - Intergenic
995086484 5:108116820-108116842 ACAAGGCTGCTGGCCAGATTGGG - Intronic
995373733 5:111450495-111450517 AACAGACATGTGGCCAGATGCGG + Intronic
995659109 5:114461414-114461436 AACAGGCAGCCAGCCTGATTAGG - Intronic
996124917 5:119713357-119713379 AACAGGAGGCAGGCCATATTTGG + Intergenic
996478489 5:123948023-123948045 AACAGGTTGCAAGCCAGATTTGG - Intergenic
996533695 5:124553450-124553472 AACAAGCAGTGGGCCAGACTTGG + Intergenic
996549373 5:124713356-124713378 AACAGACAGTGGGCCAGATTTGG - Intronic
996892619 5:128440428-128440450 AGCAGGCACCTGGCCAGAGCAGG + Intronic
997018706 5:129970034-129970056 AAGAGGCAGCTTTGCAGATTTGG - Intronic
997123952 5:131206841-131206863 AAAAGGCAGCAAGTCAGATTTGG - Intergenic
997841975 5:137250016-137250038 AACAGGTGGCAGGCCAGATTTGG - Intronic
998674862 5:144395892-144395914 AACAGGAAGCAGACCAGAGTCGG - Intronic
998790494 5:145761738-145761760 AGCAGGCAGCCGGCTAAATTTGG + Intronic
998852280 5:146362760-146362782 AACAGGCAGCAGGCCAGCTTTGG + Intergenic
998871031 5:146551901-146551923 AACAGGCAGCAGGCTGGATTTGG + Intergenic
999054723 5:148562101-148562123 AACAGACAGCAGGCTGGATTCGG - Intronic
999069868 5:148732883-148732905 AACAGGAAGTGGGCCACATTTGG - Intergenic
999121316 5:149211652-149211674 CACAACCAACTGGCCAGATTTGG - Intronic
999325627 5:150641598-150641620 AACAAGCAGCTGTCCACAGTGGG + Intronic
999649503 5:153751446-153751468 AACAGGCGGCAGGCTGGATTTGG - Intronic
1000003400 5:157161874-157161896 TCCAGGCAGCTGGTAAGATTTGG + Exonic
1000008677 5:157211554-157211576 AACAGACAGCAGGCTGGATTTGG - Intronic
1000129130 5:158278172-158278194 AACAGGCAGCATGCTGGATTTGG - Intergenic
1000461463 5:161525197-161525219 AACAGTCACCTGGTCAGATCTGG + Intronic
1000609006 5:163355159-163355181 AACAGACAGATGGCTGGATTTGG + Intergenic
1000618314 5:163455064-163455086 AACAGGTAGTGGGCCAAATTTGG + Intronic
1000653297 5:163844949-163844971 AATAGGCAAGGGGCCAGATTTGG - Intergenic
1000718269 5:164674522-164674544 AACAGACCTCTGGGCAGATTAGG - Intergenic
1000896250 5:166859071-166859093 AACAGGTTGTCGGCCAGATTTGG + Intergenic
1000903954 5:166940491-166940513 AACAGGCGGGTGGCTGGATTTGG - Intergenic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1000955351 5:167536520-167536542 AACAGGCTGCAGACTAGATTTGG + Intronic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1001010379 5:168092333-168092355 AACAGGCAGTGGGCCAGATTAGG - Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1001149588 5:169215616-169215638 AGCAGGCAGTGGGCCAAATTTGG + Intronic
1001155643 5:169270351-169270373 AACAGGCAGTGGGCCGGATCGGG - Intronic
1001220786 5:169898813-169898835 AACAGGTAGCAGGCAAGATTTGG + Intronic
1001709791 5:173769084-173769106 AACAGGCAAGGGGCCAGATTTGG - Intergenic
1001857614 5:175026396-175026418 AACAGGTTGTGGGCCAGATTTGG - Intergenic
1001923569 5:175619476-175619498 AACAGGCAGTAGGCTGGATTTGG + Intergenic
1002086351 5:176778060-176778082 AACAGGTGGTAGGCCAGATTTGG - Intergenic
1002114896 5:176952465-176952487 AATAGGCAGCTGACAGGATTTGG - Intronic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1002435454 5:179228378-179228400 AACAGGCTGGTGCCCAGACTGGG - Intronic
1002653556 5:180723410-180723432 AAGAAACAGCTGGCCAGTTTAGG + Intergenic
1003304447 6:4913850-4913872 AACAGGAAGCAGCCCAGATTTGG + Intronic
1004568710 6:16824137-16824159 AACAGGCAGCAGGCCAGAATTGG - Intergenic
1004835313 6:19524465-19524487 AACAGGCAACAGGGCAGATTTGG - Intergenic
1004902552 6:20207502-20207524 AACAGGCAGTGGGCTGGATTTGG - Intronic
1004922357 6:20387920-20387942 AACAGACAGTGAGCCAGATTTGG + Intergenic
1005151407 6:22755937-22755959 TACAGGCAGAGGGCCAGATTTGG - Intergenic
1005489945 6:26338527-26338549 AACAGGTAGCAGGCCACATTTGG - Intergenic
1005525938 6:26648944-26648966 AACAGGTGGCAGGCCAGAATTGG - Intronic
1006714865 6:36111071-36111093 AACAGGTGGTGGGCCAGATTTGG - Exonic
1006902109 6:37509673-37509695 AACAGGCAGCAAGCTGGATTTGG - Intergenic
1007178866 6:39914226-39914248 AACAGGCAGGGGGCTAGATGTGG + Intronic
1007224630 6:40304272-40304294 AACAGGCATCGGGCTGGATTTGG + Intergenic
1007941697 6:45787602-45787624 AACAGGCCGCTGGCCAGATGTGG + Intergenic
1008253060 6:49264639-49264661 CACAGCCTGCTGGTCAGATTGGG - Intergenic
1008589688 6:52981648-52981670 AACAGGTGGCAGGCCAGGTTTGG + Intronic
1008976452 6:57433021-57433043 AATAAGCAGCTGGCTATATTTGG - Intronic
1008987709 6:57564953-57564975 AACAGGCAGCTGTCTGGATTTGG + Intronic
1009176314 6:60463558-60463580 AACAGGCAGCTGTCTGGATTTGG + Intergenic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1010065854 6:71681714-71681736 AGCAAGCAGCTGGCCAGATTTGG + Intergenic
1010416082 6:75613149-75613171 AACAGGCAGCTGGACAAATTTGG - Intronic
1010436701 6:75839476-75839498 AACATGAAGCTGGCCAGGCTTGG - Intronic
1010437344 6:75849138-75849160 AACAGGCAGTGGGTCAAATTTGG - Intronic
1010735044 6:79434762-79434784 AACAGGCAGCGGGCTGAATTTGG - Intergenic
1010955294 6:82084004-82084026 AACAGGCTGCTGGATTGATTTGG + Intergenic
1011272677 6:85594561-85594583 AAGAGGCAGGTTGGCAGATTAGG + Intronic
1011546977 6:88492033-88492055 AACAGGCTGTGGGCCAGATTGGG - Intergenic
1011812777 6:91152256-91152278 AATAGGCTGCAGGCTAGATTTGG + Intergenic
1012305514 6:97652427-97652449 AACAAGCAACTGGCCAGGTTTGG + Intergenic
1012405191 6:98888191-98888213 AACAGGCAGTAGGCTGGATTTGG - Intronic
1012436679 6:99222413-99222435 GCCAGGCAGTGGGCCAGATTTGG + Intergenic
1012467778 6:99534687-99534709 AACAGGTAGCAGGTCAGATTTGG + Intergenic
1013122725 6:107155435-107155457 ATCAGGCTGCTGGCCAGGTGCGG - Intronic
1013198124 6:107863936-107863958 AAGTGGAAGCTGGCCAGATCAGG - Intergenic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013435642 6:110103152-110103174 AACAGGGAGCAGGTCAGATTTGG - Intronic
1013455418 6:110325430-110325452 AACAGGCAGCAGGCTGGATTGGG + Intronic
1013655057 6:112237895-112237917 AACAGTCTCCTGGCTAGATTGGG - Intronic
1013745248 6:113337647-113337669 ACCAGGCAGCAGGCCAGATGTGG + Intergenic
1013801748 6:113953802-113953824 AAGAGGCAATTGGCCAAATTTGG - Intronic
1014431805 6:121379828-121379850 AACTGGAGGCAGGCCAGATTTGG - Intergenic
1014486966 6:122010977-122010999 AACAGGTAGTAGGCTAGATTTGG + Intergenic
1014727475 6:124989739-124989761 AACAGGCAGCAGGTTAGATGTGG + Intronic
1015140009 6:129920303-129920325 AACAGGGAGTGGGCTAGATTTGG + Intergenic
1015170049 6:130242365-130242387 AACAGGCAGTAGGCCAGATTTGG + Intronic
1015283521 6:131459201-131459223 AACAGGCAGCAGACCAGATTTGG + Intergenic
1015597418 6:134878993-134879015 AACAGTCAGTGGGCCAGATCTGG - Intergenic
1015630540 6:135227960-135227982 AACAGGAAGTGGGCCAGATTTGG - Intergenic
1015650135 6:135447835-135447857 AACAGGTAGTAGGCCAGATTTGG - Intronic
1015726799 6:136307427-136307449 AACAGGCTGCAGGCTAAATTTGG - Intergenic
1016430555 6:143980905-143980927 AATAGGCAGTGGTCCAGATTTGG - Intronic
1016921679 6:149301083-149301105 AACAGGCAGAGGTCCACATTGGG + Intronic
1016929917 6:149394992-149395014 AACAGGCAGTGGGCTAGATTTGG + Intronic
1017265932 6:152446275-152446297 AACAGGCAACTGGCTAAATGTGG + Intronic
1017440227 6:154457998-154458020 AACAGGCAGCTGGCAGGATTTGG - Intronic
1017631756 6:156402774-156402796 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1017789993 6:157789489-157789511 AAGAGGCAGCAGGCTGGATTTGG + Intronic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1019553451 7:1616546-1616568 AGCAGGCAGCAGGCTGGATTTGG - Intergenic
1019911636 7:4104001-4104023 AACAGGAAGTGGGCCAGATTCGG + Intronic
1020352257 7:7233726-7233748 AACAGGTAGCAGGCCAGGTTTGG + Intronic
1020412947 7:7913492-7913514 AACAGGTGGTGGGCCAGATTTGG - Intronic
1020579630 7:9979705-9979727 AACAGGCAGCGGGCTGGATTTGG + Intergenic
1020884142 7:13801828-13801850 AACAGGCAGTTGGCCACATTTGG - Intergenic
1020912984 7:14156610-14156632 AACAGGCAGCTGGTCAGATTTGG + Intronic
1020925768 7:14322131-14322153 AACAGGCAGCAGGCCAGATCTGG - Intronic
1021348250 7:19554903-19554925 AACAGGCAGCTGACTAGATTTGG - Intergenic
1021664643 7:22963747-22963769 AACAGGCATCAGGCCAGACTGGG + Intronic
1021695890 7:23276111-23276133 AACAGGTGGTAGGCCAGATTTGG + Intergenic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1021953864 7:25804016-25804038 AACAGGCAGTGGATCAGATTTGG - Intergenic
1022054161 7:26711961-26711983 AACTGGCAACTGACCAAATTAGG + Intronic
1022099819 7:27162251-27162273 GCCAGGCAGCTGGCCTGTTTGGG + Intergenic
1022182138 7:27931293-27931315 AACAGGTGGAGGGCCAGATTTGG + Intronic
1022270493 7:28802784-28802806 ATTAGGCAGCGGGCCAGATTTGG - Intronic
1022455818 7:30557403-30557425 AACAGGTGGTGGGCCAGATTTGG - Intergenic
1022841252 7:34165935-34165957 AAAAGGCAGTCAGCCAGATTTGG - Intergenic
1023105434 7:36759318-36759340 AACAGGCAGTGGGCTGGATTTGG + Intergenic
1023356559 7:39372833-39372855 AACAGGCTATGGGCCAGATTCGG + Intronic
1023385252 7:39650263-39650285 AACAGGCAGCAGGCTGAATTTGG - Intronic
1023532046 7:41168074-41168096 AACAGGCATCAGGCTGGATTTGG - Intergenic
1023654273 7:42404064-42404086 AATAGGCAGCAACCCAGATTTGG - Intergenic
1024988454 7:55215693-55215715 AATAGGCTGCTGACTAGATTTGG - Intronic
1025845571 7:65193500-65193522 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1025895790 7:65699213-65699235 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1025922274 7:65924582-65924604 AACAAGCAGTGGGCTAGATTTGG + Intronic
1026291053 7:69006515-69006537 AACGGGCATCAGGCCAGATTTGG - Intergenic
1026571340 7:71533984-71534006 AACAGGCAGTTGTCCAGATGCGG + Intronic
1026949264 7:74336681-74336703 AATAGGCAGCAGGACTGATTTGG - Intronic
1027261569 7:76468429-76468451 AAATGGCAGTGGGCCAGATTTGG - Intronic
1027312948 7:76966538-76966560 AAATGGCAGTGGGCCAGATTTGG - Intergenic
1027329523 7:77077267-77077289 AACAGGCCCCTGGCCAGATTTGG - Intergenic
1027846084 7:83377523-83377545 GATAGGCAGAGGGCCAGATTTGG + Intronic
1028093115 7:86727800-86727822 AGCAGGTGGCGGGCCAGATTTGG - Intronic
1028266949 7:88737257-88737279 AACAAGCAGCTGTCCAGAATGGG - Intergenic
1028340401 7:89712380-89712402 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1028340775 7:89717390-89717412 AACAAGTAGTTGGCCATATTTGG + Intergenic
1028572968 7:92312661-92312683 AACAGGCAGCAGGTTTGATTTGG + Intronic
1028783167 7:94760732-94760754 ATCAGGCAGCCAGTCAGATTTGG + Intergenic
1028932920 7:96433747-96433769 AACAAGCAGTGGGCCAAATTTGG + Intergenic
1029011274 7:97264272-97264294 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1029051501 7:97693765-97693787 ACCAGGCAGTGGGCCAGATTTGG + Intergenic
1029070073 7:97888420-97888442 TACAGTCAGAGGGCCAGATTTGG - Intergenic
1029786239 7:102794094-102794116 AACAGGCCCCTGGCCAGATTTGG + Intronic
1030124795 7:106143598-106143620 AACAGGGGGCTGGCCAGGTATGG - Intergenic
1030346686 7:108441762-108441784 AATTGGCGGCAGGCCAGATTTGG - Intronic
1030778134 7:113562446-113562468 AACTGGCAGCAGGCTGGATTTGG + Intergenic
1030797740 7:113809684-113809706 AACAGGCAACGGGCCAGATGGGG - Intergenic
1031189684 7:118531779-118531801 AACAGGCAGAAGGCTAGATTTGG + Intergenic
1031205075 7:118746224-118746246 AACAGGCAGTGGGCCAGGCTTGG + Intergenic
1031221468 7:118971941-118971963 AGCAGGGAGCTGGCTGGATTTGG - Intergenic
1031750585 7:125567870-125567892 AACAGGCAGAGGGTTAGATTTGG - Intergenic
1031930217 7:127677827-127677849 AACAGGCAGTAGGCTGGATTTGG + Intronic
1032865763 7:135922476-135922498 AACAGGCAATGGGCCAGATTCGG + Intergenic
1033205856 7:139421666-139421688 TACAGGCTACCGGCCAGATTTGG - Intronic
1034386603 7:150745679-150745701 AACAGGTGGTGGGCCAGATTTGG - Intronic
1034507917 7:151509679-151509701 AACAGGCTGTAGGCCAAATTTGG - Intronic
1034877296 7:154736526-154736548 AAGAGACAGCAAGCCAGATTTGG + Intronic
1034904383 7:154931010-154931032 AAATAGCAGGTGGCCAGATTTGG + Intronic
1035155172 7:156906301-156906323 CAAAGGCAGCTGTCCAGGTTGGG + Intergenic
1036163267 8:6407810-6407832 AACAGGCAGCAGGCTAGATATGG - Intronic
1036214575 8:6868358-6868380 AACAGGCAGCAAGCCAGATTTGG - Intergenic
1036248481 8:7141271-7141293 AACAGTCAGAGGGCCAGATTTGG + Intergenic
1036252325 8:7173066-7173088 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1036365169 8:8114394-8114416 AACAGTCAGAGGGCCAGATTTGG + Intergenic
1036738335 8:11339474-11339496 AACAGGCAGCGGGCCAGATTTGG - Intergenic
1036885758 8:12551707-12551729 TACAGTCAGAGGGCCAGATTTGG - Intergenic
1036893387 8:12610793-12610815 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1037072772 8:14673009-14673031 AACACACAGCAGGCAAGATTTGG + Intronic
1037333169 8:17764750-17764772 AAGAGGCAGTGGGCCAGACTTGG + Intronic
1037352081 8:17971214-17971236 AACAGGCAGCAGGCTGAATTTGG + Intronic
1037622322 8:20575670-20575692 AACAGGCAGTAGGCCAGAGTTGG + Intergenic
1038536601 8:28358054-28358076 AACAAGCAGCAGGCTACATTGGG - Intronic
1038561944 8:28588443-28588465 AATAGGCTGTGGGCCAGATTGGG + Intergenic
1039104068 8:33971216-33971238 AATAGGCTGCAGGCCAGATTTGG - Intergenic
1039265866 8:35823270-35823292 AACAGGTAGCTGGCTAGATTTGG + Intergenic
1039687247 8:39816912-39816934 AACAGCCTGTGGGCCAGATTTGG + Intronic
1040407481 8:47120345-47120367 AACAGGCAGTGGGCTGGATTTGG - Intergenic
1040845071 8:51829399-51829421 AAAAAGCAGCTGGCCATGTTTGG + Intronic
1041123216 8:54608165-54608187 AAAAGGCAGATGGCCAAAATAGG - Intergenic
1041541317 8:58988306-58988328 AGCAGACAGCAGACCAGATTTGG - Intronic
1042029402 8:64459191-64459213 AACAGGTAGCAGGCTAGCTTGGG + Intergenic
1042330909 8:67579677-67579699 AACAGGCAGCAGGCCAGATATGG - Intronic
1043326311 8:79056175-79056197 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1043780455 8:84327505-84327527 AAGAGGTAGCAGGCCAGATATGG - Intronic
1043843081 8:85132254-85132276 AATAGGCAGTGGGCCATATTTGG - Intronic
1043851499 8:85221278-85221300 GACTGGCAGCTGGCCAAGTTAGG + Intronic
1044311759 8:90701505-90701527 AACAAGTGACTGGCCAGATTTGG + Intronic
1044313240 8:90719529-90719551 AACAGGTAGCAGGCCAGATTTGG + Intronic
1044387999 8:91612757-91612779 AGCAGGCAGTGGGCCAGATTTGG + Intergenic
1044488031 8:92776281-92776303 TACAGGCAGCATGGCAGATTTGG + Intergenic
1044977962 8:97684431-97684453 AACAGGCATCTGTCTGGATTTGG - Intronic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1045140529 8:99276622-99276644 AGCAGGAAGTGGGCCAGATTTGG + Intronic
1045186754 8:99845878-99845900 AGCAGGCAGTGGACCAGATTTGG + Intronic
1045227117 8:100259712-100259734 AACAGTGAGCTGTCCAGAGTAGG - Intronic
1045356451 8:101393452-101393474 ATCAGGCAGTGGTCCAGATTTGG + Intergenic
1045564942 8:103304679-103304701 AACAGGCAGTGGGCTATATTTGG + Intronic
1045576587 8:103428310-103428332 AACAGGCAGTGGGCCACATGTGG - Intronic
1045846513 8:106643342-106643364 AACAGATGGCCGGCCAGATTTGG + Intronic
1046753703 8:117951755-117951777 AACAGGTGGCAGGCCAGATTTGG - Intronic
1046885945 8:119367274-119367296 AACAGTCAGCAGACCAAATTTGG + Intergenic
1046964497 8:120148892-120148914 AATAGGCAGTGGGCCAGATTTGG - Intronic
1047026790 8:120833109-120833131 AACAGGTAGCAGGTCAGATTTGG - Intergenic
1047414020 8:124649122-124649144 AACAGGCAGTGGGCCGGATTTGG - Intronic
1047425719 8:124743836-124743858 AGCATGCAGTAGGCCAGATTTGG - Intergenic
1047426667 8:124752713-124752735 AGCAGGCGGTGGGCCAGATTTGG - Intergenic
1047485844 8:125330078-125330100 AACAGGTAGCTTTACAGATTCGG + Intronic
1047676781 8:127211236-127211258 AACAGGTGGCAGGACAGATTTGG + Intergenic
1047866381 8:129028563-129028585 AACAGGCAGTGGGTTAGATTTGG + Intergenic
1047886115 8:129251739-129251761 ACCAGGCAGCAGGCTAGATTTGG - Intergenic
1047892665 8:129329885-129329907 AACAGGTAGAAAGCCAGATTTGG + Intergenic
1048965826 8:139613825-139613847 CACAGGCAGCTGGCCTGCATGGG + Intronic
1049198429 8:141328095-141328117 AACAGGTGGCTGGCCAGCTTTGG + Intergenic
1049996583 9:1040823-1040845 AACCTGCAGCTGGCCAGAAGCGG - Intergenic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1050440534 9:5657767-5657789 AACAGGCACCAGGGCATATTTGG - Intronic
1050622072 9:7464535-7464557 AACAGGCAGCAAGCTAGATTTGG + Intergenic
1050859522 9:10409030-10409052 AACAGGCTGTAGGCCAGATTTGG - Intronic
1051066560 9:13111141-13111163 AACAGGCAGTGGGCCAAATTTGG - Intronic
1051105297 9:13572396-13572418 AAGAGGAAGAAGGCCAGATTTGG - Intergenic
1051486456 9:17613905-17613927 ACCAGGCAGCTTGCCAAATAAGG - Intronic
1051608720 9:18941494-18941516 AACAGGCTGCTGGCCAGATCTGG + Intronic
1051677056 9:19569261-19569283 AACAGGCTGCAGGCCAGATTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1052033786 9:23657574-23657596 GACATGCAGTGGGCCAGATTGGG - Intergenic
1052238104 9:26237354-26237376 AACAGGCAGCAGGCCAGAGCTGG + Intergenic
1052480266 9:29015555-29015577 AATAGACAGCAGGTCAGATTTGG + Intergenic
1052601719 9:30640846-30640868 AACAGGTGGTGGGCCAGATTTGG + Intergenic
1052726863 9:32239066-32239088 GTCAGACAGCTGGCCAAATTTGG - Intergenic
1053191850 9:36078132-36078154 AACAGGTGGCAGGCAAGATTTGG + Intronic
1053346664 9:37383306-37383328 AAAAGGCAGCTGGTCAGAGAAGG + Intergenic
1053362318 9:37497503-37497525 CACAGGCAGCAGGCCAGACTTGG - Intronic
1053512254 9:38697941-38697963 AATGGGTAGCTGGCCAGATTTGG - Intergenic
1053515137 9:38723999-38724021 AAAGGGCAGTGGGCCAGATTTGG - Intergenic
1054981281 9:71209665-71209687 AAGAGGCAGCAGGCTGGATTTGG - Intronic
1055134594 9:72813684-72813706 AACAGGTGGCAGTCCAGATTTGG + Intronic
1055189450 9:73499292-73499314 AAAAGGCAGGTGGACAGGTTTGG - Intergenic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1055749819 9:79492753-79492775 AACAGGCAGTGAGTCAGATTGGG + Intergenic
1056145490 9:83724789-83724811 AACAGGCAGCAGATCTGATTTGG + Intergenic
1056237378 9:84608248-84608270 AACAGGTGGCTAGCCAGATTTGG - Intergenic
1056285919 9:85088129-85088151 AACAGGCTGCAGGCCAGCTTTGG + Intergenic
1057198825 9:93129780-93129802 CCCAGGCAGCAGGCCACATTGGG + Intronic
1057397385 9:94692250-94692272 AGCAGGCAGTGGACCAGATTTGG + Intergenic
1057506931 9:95642435-95642457 AACAGGCAATGGGCCAGAATTGG + Intergenic
1057519272 9:95748357-95748379 ATCAGGCTGAGGGCCAGATTTGG + Intergenic
1057552538 9:96062621-96062643 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1057763706 9:97897490-97897512 AACAGGCTGTGGGCCAGATTTGG + Intergenic
1058167370 9:101635276-101635298 AACTGGTAGCAGGCTAGATTTGG - Intronic
1058372585 9:104286873-104286895 AACAGCTAGTGGGCCAGATTTGG + Intergenic
1058468417 9:105251956-105251978 AACAGGTAGCAGGTCAGATTTGG - Intronic
1058646776 9:107138403-107138425 AACAGGCAGTGGGCCAAATTTGG - Intergenic
1058946788 9:109864590-109864612 CACAGGTAGTGGGCCAGATTTGG - Intronic
1059108736 9:111534662-111534684 AACAGGAAGGAGGGCAGATTGGG + Intronic
1059258209 9:112949988-112950010 AACAGGCAGTGGGCTGGATTTGG + Intergenic
1059319600 9:113458342-113458364 AACAGGCAGCCAGCCAGATTTGG + Intronic
1059424112 9:114210165-114210187 AACAGACAACTGGCTGGATTTGG - Intronic
1059534282 9:115066646-115066668 AATAAGCAGCTGGCCAGATGTGG - Intronic
1059662222 9:116413190-116413212 AATAGGCAGAGGTCCAGATTTGG - Intergenic
1059666377 9:116450139-116450161 AATAGGCAGTGGGCCAGATTTGG - Intronic
1059909099 9:119022575-119022597 AACAGGAAGGAGGTCAGATTTGG - Intergenic
1059938979 9:119339277-119339299 GACTGGGAGCGGGCCAGATTTGG + Intronic
1059946867 9:119418139-119418161 AACAGGCAATAGGCCAGACTTGG + Intergenic
1060223774 9:121778760-121778782 AACAGGCAATGGTCCAGATTTGG + Intronic
1060363108 9:122980040-122980062 AACAGGTGGCAGACCAGATTAGG - Intronic
1060382712 9:123191738-123191760 AACAGGCAATGGGCCAAATTTGG + Intronic
1060532690 9:124357348-124357370 AACAGGCAGTGGGCCAGATCTGG + Intronic
1060589056 9:124804384-124804406 AACAGGCTGTGGGCTAGATTTGG - Intronic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1062059125 9:134485490-134485512 AGCAGGCAGCAGGCCACATGTGG - Intergenic
1062597306 9:137305080-137305102 AAGGGGCAGCTGGCCAGAGCTGG + Intergenic
1062729150 9:138098922-138098944 CAGAGGCAGCTGAGCAGATTGGG + Intronic
1203528814 Un_GL000213v1:116929-116951 AACAGGCAGTGGGCTGGATTTGG - Intergenic
1203531317 Un_GL000213v1:145357-145379 AAGTGGCAGCAGGCTAGATTTGG - Intergenic
1185816190 X:3158295-3158317 AACAGGCTGTGGGCCAGATTTGG + Intergenic
1186157654 X:6742303-6742325 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1186253081 X:7690192-7690214 AACAAGTAGTGGGCCAGATTTGG - Intergenic
1186343039 X:8663380-8663402 AATAGGTAGCAGGGCAGATTTGG + Intronic
1186370592 X:8942921-8942943 AACATGTAGCAGGCCAAATTTGG + Intergenic
1186482649 X:9907756-9907778 AACAGACAGGGGGCCAGAGTTGG - Intronic
1186519595 X:10193782-10193804 AACAGGCTGTGGGCCAGATTTGG + Intronic
1186520740 X:10204703-10204725 AATAGGTAGTGGGCCAGATTTGG + Intronic
1186546320 X:10453586-10453608 AACAGGCAGAGGGCCAGAGTTGG - Intronic
1186546417 X:10454529-10454551 ACCAGGTAGCAGGCCAGGTTTGG + Intronic
1186547976 X:10470912-10470934 AACAGGCAGTGGGCCAGACTTGG - Intronic
1186592562 X:10946669-10946691 AGCAGGCAATGGGCCAGATTTGG + Intergenic
1186673305 X:11789115-11789137 AGCAGGCAGGAGGCCTGATTTGG - Intergenic
1186701949 X:12099950-12099972 AACAAGCCACAGGCCAGATTTGG - Intergenic
1186706342 X:12143264-12143286 AACAGTCAGCAAGCCAGATTTGG - Intronic
1186708674 X:12169926-12169948 AACAGGCAGTGGGCCAGATTTGG + Intronic
1186716913 X:12262097-12262119 AACAGGCAGGGGACAAGATTTGG - Intronic
1186748105 X:12591514-12591536 AACAGGCAGAGGGCCAGATTTGG - Intronic
1186753162 X:12642564-12642586 AACAGGTAGTAGGCCAGATTTGG - Intronic
1186842521 X:13498373-13498395 AACAGGCAGTATGCCAGATTTGG - Intergenic
1186846153 X:13533075-13533097 AACAGGAAGCAGGACACATTTGG - Intergenic
1186896322 X:14007962-14007984 AACAGACTGCAGGCCAGATTTGG - Intergenic
1186927715 X:14353343-14353365 AACAAGCAGTAGGCCAGATTTGG - Intergenic
1186945485 X:14561405-14561427 AACAGGTGGTAGGCCAGATTCGG - Intronic
1187020725 X:15378718-15378740 AACAGGCTGCAGGTTAGATTTGG - Intronic
1187040844 X:15594143-15594165 AACAGGCAGCAGACAGGATTTGG - Intronic
1187080546 X:15982079-15982101 AACAGGCTAAGGGCCAGATTTGG - Intergenic
1187094837 X:16136940-16136962 AACAGGCAGTGGACCAGACTTGG + Intronic
1187186143 X:16987753-16987775 AACAGACAGTGGGCCAGATTTGG + Intronic
1187364481 X:18655272-18655294 AACAAGCAGAGGGCCAGATGTGG - Intronic
1187409094 X:19032799-19032821 AACAGGCAGTGAGCCCGATTTGG + Intronic
1187563107 X:20420830-20420852 AACAGGCAGAGGGCTATATTTGG + Intergenic
1187708279 X:22028666-22028688 AACAGGCAGTGGGCCAAATTTGG + Intergenic
1187724498 X:22188482-22188504 AACAGGCAGCAGGTGAGATTTGG - Intronic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1187811753 X:23186651-23186673 AACAGAAAGTTGGCTAGATTTGG + Intergenic
1187881565 X:23852212-23852234 AACAGGGTGCTGGCCAGGTGTGG - Intronic
1188282870 X:28291740-28291762 AACATGCTGTTGGCTAGATTTGG - Intergenic
1188310555 X:28611924-28611946 AACAGGTGGCTGGCTGGATTTGG - Intronic
1188335586 X:28928235-28928257 AACAGAAAAGTGGCCAGATTTGG - Intronic
1188454700 X:30350551-30350573 AACAGGCCGTAAGCCAGATTTGG + Intergenic
1188472649 X:30557849-30557871 AGCAGGCAGCAGGCTAGATCTGG + Intergenic
1188530024 X:31129669-31129691 AACAGGTATTGGGCCAGATTTGG + Intronic
1188588553 X:31805929-31805951 AACAGGCAGTTGGTTGGATTTGG - Intronic
1189339717 X:40195564-40195586 AACAGGCAGCTGGCCAGATCTGG + Intergenic
1189469246 X:41301361-41301383 AACTGGAAGCAGGCCAGAGTTGG - Intergenic
1189778294 X:44489740-44489762 AACAGACAGCAGGGTAGATTTGG + Intergenic
1190027596 X:46939802-46939824 AACAGGTAGCAGACTAGATTTGG - Intronic
1190755330 X:53396410-53396432 AGCAGGCAGCCTGCCAGATTTGG - Intronic
1190794506 X:53728502-53728524 AACAGGCAGCAGGCTGGATTTGG - Intergenic
1192182562 X:68925369-68925391 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1192296412 X:69853930-69853952 AACACACTGCAGGCCAGATTTGG + Intronic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1192489784 X:71565819-71565841 AACTGGCAGTATGCCAGATTTGG + Intronic
1192710938 X:73587024-73587046 AACAGGCAGCAAGCCAGATCTGG + Intronic
1192777863 X:74263806-74263828 AACAAGCGGTTGGCCAGATTTGG + Intergenic
1193104815 X:77658717-77658739 AACAGGCAGAGGATCAGATTTGG + Intronic
1193223443 X:78954161-78954183 ATCAGGCTGCTGGCCAGGTGTGG - Intronic
1193743088 X:85242404-85242426 AACAGGCAGCAGTCCAGATTTGG - Intergenic
1194710861 X:97234783-97234805 AACAGGCAGCCAGCTAGATATGG + Intronic
1194749906 X:97672523-97672545 AACAGACAGATGGCTGGATTTGG + Intergenic
1194960612 X:100231155-100231177 AACAGGTGGCGGGCCTGATTTGG + Intergenic
1195278539 X:103308146-103308168 AATAGGCAGTGGGCCAGATTTGG + Intergenic
1195374151 X:104209839-104209861 AACATGCAGCAGGCTGGATTTGG - Intergenic
1195425843 X:104729429-104729451 AAAAGGCAGCAGGCCCTATTTGG - Intronic
1195447223 X:104966982-104967004 AACAGGCAGTAGGCCAGTCTTGG + Intronic
1195470217 X:105221235-105221257 ACCAGGCAGTTGGCATGATTTGG + Intronic
1195590158 X:106615326-106615348 AACAAGCAACAGGCAAGATTTGG + Intronic
1195622787 X:106974154-106974176 AACAGGCAGTGGGCTGGATTTGG - Intronic
1195684611 X:107574343-107574365 AACAGGCAGTGAGTCAGATTTGG - Intronic
1197622393 X:128765201-128765223 AACAGGCAGAGAGCCAGGTTTGG + Intergenic
1198002395 X:132452317-132452339 AACAGGAAGCTTGACACATTTGG + Intronic
1198419620 X:136457396-136457418 AACAGATGGCAGGCCAGATTTGG + Intergenic
1198457059 X:136827244-136827266 AACAGGCAGTGGGCTGGATTTGG - Intergenic
1198532547 X:137560448-137560470 AACAGGCTATGGGCCAGATTTGG + Intergenic
1199210574 X:145205321-145205343 AATAGGTCACTGGCCAGATTTGG + Intergenic
1199712606 X:150480949-150480971 AACTGGAAGATGGCCGGATTTGG - Intronic
1200167848 X:154049653-154049675 AACAGGCAGTGGGCCGGACTTGG + Intronic
1201469881 Y:14321441-14321463 AACAAGCAGTAGGCCAGATTTGG - Intergenic
1201551207 Y:15218709-15218731 AGCAGGCAGTGGGCCAGATTTGG - Intergenic
1201589518 Y:15599561-15599583 TACAGGCACCTGGCTAGTTTTGG - Intergenic
1202033949 Y:20612050-20612072 AACAAGCAGTTGGCCAGTTGTGG + Intergenic
1202580002 Y:26370389-26370411 AACAGGCAGTGGGCTGGATTTGG + Intergenic